Penny Arcade: News Post: Rocket League Got Some PA Goodies!

Gabe: PAX is just around the corner and the folks over at Rocket League have added some cool Penny Arcade/PAX items to their game! Hopefully you’ve been watching the Acquisitions Inc. series on YouTube. If not you should catch up on it now because the live game we play at PAX will pick up right where this series leaves off. If you can’t make it to PAX, the Live game will be presented as a Fathom event this year which means you can watch it live at a movie theater near you. The Twitch stream isn’t going anywhere but there’s something about watching it with a big group…

Bifurcated Rivets: From FB

This is rather good

Bifurcated Rivets: From FB

Nuclear lighthouses

Bifurcated Rivets: From FB

Excellent

Bifurcated Rivets: From FB

A couple that are new to me

Bifurcated Rivets: From FB

RIP Toots

MetaFilter: How the Hunt Brothers Cornered the Silver Market and Then Lost it All

From a spot price of around $6 per ounce in early 1979, the price of silver shot up to $50.42 in January of 1980. In the same week, silver futures contracts were trading at $46.80. Film companies like Kodak saw costs go through the roof, while the British film producer, Ilford, was forced to lay off workers. Traditional bullion dealers, caught in a squeeze, cried foul to the commodity exchanges, and the New York jewelry house Tiffany & Co. took out a full page ad in the New York Times slamming the "unconscionable" Hunt brothers. They were right to single out the Hunts; in mid-January, they controlled 69% of all the silver futures contracts on the Commodity Exchange (COMEX) in New York.

Hackaday: Exoskeleton Designed for Children

Exoskeletons are demonstrably awesome, allowing humans to accomplish feats of strength beyond their normal capacity. The future is bright for the technology — not just for industrial and military applications, but especially in therapy and rehabilitation. Normally, one thinks of adults who have lost function in their limbs, but in the case of this exoskeleton, developed by The Spanish National Research Council (CSIC), children with spinal muscular atrophy are given a chance to lead an active life.

Designing prosthetics for children can be difficult since they are constantly growing, and CSIC’s is designed to be telescopic to accommodate patients between the ages 3-14. Five motors in each leg adapt to the individual symptoms of the patient through sensors which detect the child’s intent to move and simulates what would be their natural walking gait.

The therapeutic effects of this unique exoskeleton are emphasized by CSIC, citing the psychological aspect of spinal muscular atrophy that has a further degenerative impact on the child’s life. It is currently in pre-clinical lab trials in Madrid and Barcelona to test the efficacy of the device. Combined with the marvel of 3D printing, advanced exoskeletal prosthetics for children — and adults — are rapidly approaching reality.

[via Gizmodo]


Filed under: lifehacks, Medical hacks

MetaFilter: El sueno americano

Tom Kiefer was named one of the 50 best emerging photographers for 2015 in the LensCulture Emerging Talent Awards based on his El Sueno Americano project, which emerged from his work as a janitor at the U.S. Customs and Border Patrol. Over an 11-year period, he salvaged and cataloged hundreds of personal items thrown away in the facility.

I was greatly disturbed by the volume of food, clothing and personal belongings thrown away at a single U.S. Customs and Border Patrol facility. ...
Why would someone throw away a rosary or bible? Why would someone throw away a wallet? Why would a pair of shoes, for all intents and purpose "brand new", be tossed in the trash? ... "The beacon of hope", fairness, democracy, equality, faith and grace seems more and more like a sales gimmick, limited to certain groups of people. How we treat others is a reflection of who we are. When belts, shoelaces, toothbrushes, socks, shoes, underwear, pants, shirts, jackets, watches, bibles, wallets, coins, cell phones, keys, jewellery, calling-cards, water, food, soap, deodorant, gloves, medicine, birth control pills, blankets and rosaries are considered non-essential personal property and discarded, regardless of the amount and origin, something becomes less than human.


Click on the [i] icon in the lower right to turn on title cards at the artist's website.

Slashdot: The Big Short: Security Flaws Fuel Bet Against St. Jude

chicksdaddy writes: "Call it The Big Short -- or maybe just the medical device industry's 'Shot Heard Round The World': a report from Muddy Waters Research recommends that its readers bet against (or 'short') St. Jude Medical after learning of serious security vulnerabilities in a range of the company's implantable cardiac devices," The Security Ledger reports. "The Muddy Waters report on St. Jude's set off a steep sell off in St. Jude Medical's stock, which finished the day down 5%, helping to push down medical stocks overall. The report cites the 'strong possibility that close to half of STJ's revenue is about to disappear for approximately two years' as a result of 'product safety' issues stemming from remotely exploitable vulnerabilities in STJ's pacemakers, implantable cardioverter defibrillator (ICD), and cardiac resynchronization therapy (CRT) devices. The vulnerabilities are linked to St. Jude's Merlin at home remote patient management platform, said Muddy Waters. The firm cited research by MedSec Holdings Ltd., a cybersecurity research firm that identified the vulnerabilities in St. Jude's ecosystem. Muddy Waters said that the affected products should be recalled until the vulnerabilities are fixed. In an e-mail statement to Security Ledger, St. Jude's Chief Technology Officer, Phil Ebeling, called the allegations 'absolutely untrue.' 'There are several layers of security measures in place. We conduct security assessments on an ongoing basis and work with external experts specifically on Merlin at home and on all our devices,' Ebeling said." More controversial: MedSec CEO Justine Bone acknowledged in an interview with Bloomberg that her company did not first reach out to St. Jude to provide them with information on the security holes before working with Muddy Waters. Information security experts who have worked with the medical device industry to improve security expressed confusion and dismay. "If safety was the goal then I think (MedSec's) execution was poor," said Joshua Corman of The Atlantic Institute and I Am The Cavalry. "And if profit was the goal it may come at the cost of safety. It seems like a high stakes game that people may live to regret."

Read more of this story at Slashdot.

Recent additions: courier 0.1.1.4

Added by PhilHargett, Fri Aug 26 01:08:07 UTC 2016.

A message-passing library for simplifying network applications

Computer Science: Theory and Application: CompSci Weekend SuperThread (August 26, 2016)

/r/compsci strives to be the best online community for computer scientists. We moderate posts to keep things on topic.

This Weekend SuperThread provides a discussion area for posts that might be off-topic normally. Anything Goes: post your questions, ideas, requests for help, musings, or whatever comes to mind as comments in this thread.

Pointers

  • If you're looking to answer questions, sort by new comments.
  • If you're looking for answers, sort by top comment.
  • Upvote a question you've answered for visibility.
  • Downvoting is discouraged. Save it for discourteous content only.

Caveats

  • It's not truly "Anything Goes". Please follow Reddiquette and use common sense.
  • Homework help questions are discouraged.
submitted by /u/AutoModerator
[link] [comments]

explodingdog: Photo



Slashdot: US Unveils Charges Against KickassTorrents, Names Two More Defendants

A total of three men are said to be operators of file-sharing site KickassTorrents (KAT), according to U.S. prosecutors. Last month, federal authorities arrested the 30-year-old Ukrainian mastermind of KAT, Artem Vaulin, and formally charged him with one count of conspiracy to commit criminal copyright infringement, one count of conspiracy to commit money laundering, and two counts of criminal copyright infringement. Two other Ukrainians were named in the new indictment (PDF): Levgen (Eugene) Kutsenko and Oleksander (Alex) Radostin. While only Vaulin has been arrested, bench warrants have been issue for the arrest of all three men. Ars Technica reports: "Prosecutors say the three men developed and maintained the site together and used it to 'generate millions of dollars from the unlawful distribution of copyright-protected media, including movies, [...] television shows, music, video games, computer software, and electronic books.' They gave out 'Reputation' and 'User Achievement' awards to users who uploaded the most popular files, including a special award for users who had uploaded more than 1,000 torrents. The indictment presents a selection of the evidence that the government intends to use to convict the men, and it isn't just simple downloads of the copyrighted movies. The government combed through Vaulin's e-mails and traced the bitcoins that were given to him via a 'donation' button."

Read more of this story at Slashdot.

Computer Science: Theory and Application: Can someone explain a part of the XOR identity proof?

I am confused how line 1 goes to line 2 here, which law is in effect here?

submitted by /u/buglebudabey
[link] [comments]

MetaFilter: Fingerwave Saint

"I wanted to create images that portray black women in a way that would inspire them not to be necessarily pretty, which is what most beauty stuff is about, but to kind of embody that and more within themselves," Ms. Crowe said [NYT]. "Everything starts within you and how you feel about yourself. It's just trying to glorify black women and make them imagine themselves beyond their wildest dreams."
Fingerwave Saint, with its braided halo, is a nod to the depiction of holy figures in painting and portraiture...
Shani Crowe [Refinery29] on cultural appropriation:
It's strange when the source of your shame adopts the qualities you were shamed for, receives praise for these qualities, and is heralded as a trendsetter. Add the mistrust from centuries of pillaging and displacing millions of people from their native lands. If you have learned from experience to be wary of trusting someone, you are much less inclined to trust them with something as sacred as your culture.

programming: There is Now a Rust Implementation of GNU Parallel

submitted by /u/mmstick
[link] [comments]

Slashdot: Apple Patenting a Way To Collect Fingerprints, Photos of Thieves

An anonymous reader quotes a report from Apple Insider: As published by the U.S. Patent and Trademark Office, Apple's invention covering "Biometric capture for unauthorized user identification" details the simple but brilliant -- and legally fuzzy -- idea of using an iPhone or iPad's Touch ID module, camera and other sensors to capture and store information about a potential thief. Apple's patent is also governed by device triggers, though different constraints might be applied to unauthorized user data aggregation. For example, in one embodiment a single failed authentication triggers the immediate capture of fingerprint data and a picture of the user. In other cases, the device might be configured to evaluate the factors that ultimately trigger biometric capture based on a set of defaults defined by internal security protocols or the user. Interestingly, the patent application mentions machine learning as a potential solution for deciding when to capture biometric data and how to manage it. Other data can augment the biometric information, for example time stamps, device location, speed, air pressure, audio data and more, all collected and logged as background operations. The deemed unauthorized user's data is then either stored locally on the device or sent to a remote server for further evaluation.

Read more of this story at Slashdot.

ScreenAnarchy: Fantastic Fest 2016: TERRY TEO Celebrates Fest Inclusion With a New Poster

The Second Wave for Fantastic Fest dropped this afternoon and already the members of ScreenAnarchy going to this year's festival are feverishly updating and prioritizing their wish lists for that week.    From the comfort I my own home I am celebrating the inclusion of the New Zealand children's television series Terry Teo with it's director Gerard Johnstone from the other side of the Te Moana-nui-a-Kiwa. We both would like to think that it was my article about the show that prompted its addition to this year's programming. Heck, the locals did not know about the show until a couple weeks prior to its release last month in New Zealand, so this has to be true.    To celebrate Johnstone, director of the hit comedy...

[Read the whole post on screenanarchy.com...]

Instructables: exploring - featured: Home Defense Mace

Let me preface this 'ible by assuring you that I am not crazy. I feel the need to say that because whenever I tell people that I am making a mace, they look at me sideways.I find a certain elegance to some old weaponry. Some of them seem like more work of art than instrument of death. Despite the...
By: Nick70587

Continue Reading »

Instructables: exploring - featured: Leather Bush-knife Sheath

leather craft bush knife sheath. made from veg tan leather.if you enjoy my instructables please vote for them in the contests! also feel free to comment and ask questions! make a pattern trace your knife, and draw an outline around it about 1/4" around to account for stitching.be sure your knife...
By: rshulman

Continue Reading »

Slashdot: PSA: PlayStation Network Gets Two-Step Verification

Consider this a public service announcement: Sony has (finally) added two-factor authentication to PlayStation Network accounts. If you're a PlayStation user and are reading this right now, you really should go set it up so that someone doesn't try to take over your account and steal your password. Ars Technica details how you can set up the new security features: "Turn on your PS4 and go to Settings -> PlayStation Network Account Management -> Account Information -> Security -> 2-Step Verification. You can also set it up through the web by logging into your PSN account on the web and going through the Security tab under the Account header. From there, on-screen instructions will walk you through the process of using a text message to confirm your mobile device as a secondary layer of security for your PSN account. Two-factor support is not available when logging on to older PlayStation systems, so Sony recommends you generate a 'device setup password' to help protect the PS3, Vita, or PSP." Two-factor authentication comes five years after hackers breached PSN's security and stole 77 million accounts.

Read more of this story at Slashdot.

Hackaday: The Mystery Behind the Globs of Epoxy

When Sparkfun visited the factory that makes their multimeters and photographed a mysterious industrial process.

We all know that the little black globs on electronics has a semiconductor of some sort hiding beneath, but the process is one that’s not really explored much in the home shop.  The basic story being that, for various reasons , there is no cheaper way to get a chip on a board than to use the aptly named chip-on-board or COB process. Without the expense of encapsulating  the raw chunk of etched and plated silicon, the semiconductor retailer can sell the chip for pennies. It’s also a great way to accept delivery of custom silicon or place a grouping of chips closely together while maintaining a cheap, reliable, and low-profile package.

As SparkFun reveals, the story begins with a tray of silicon wafers. A person epoxies the wafer with some conductive glue to its place on the board. Surprisingly, alignment isn’t critical. The epoxy dries and then the circuit board is taken to a, “semi-automatic thermosonic wire bonding machine,” and slotted into a fixture at its base. The awesomely named machine needs the operator to find the center of the first two pads to be bonded with wire. Using this information it quickly bonds the pads on the silicon wafer to the  board — a process you’ll find satisfying in the clip below.

The final step is to place the familiar black blob of epoxy over the assembly and bake the board at the temperature the recipe in the datasheet demands. It’s a common manufacturing process that saves more money than coloring a multimeter anything other than yellow.


Filed under: misc hacks

Daniel Lemire's blog: Faster dictionary decoding with SIMD instructions

A particularly fast and effective compression technique is dictionary coding. Intuitively, it works as follow. Suppose you are given a long document made of millions of words, but containing only 65536 distinct words. You can create a map from words to short integers or indexes (in [0,65536)). So the word “the” might be replaced by 0, the word “friend” by 1, and so forth. You then replace your document with an array of 16-bit integers. So you use only 16 bits per word.

In general, given a dictionary of size N, you only need ceil(log2(N+1)) bits to represent each word. Your dictionary can be implemented, simply, as an array pointers (using 64 bits per pointer).

It may help reduce memory usage if words are often repeated. But it can also speed up processing. It much faster for a processor to seek out a given integer in a flat array than it is to seek a given word.

You can also use nice tricks to pack and unpack integers very fast. That is, given arrays of 32-bit integers that fit in b bits, you can quickly pack and unpack them. You can easily process billions of such integers per second on a commodity processor.

In my example, I have used the notions of document and word, but dictionary coding is more often found in database systems to code columns or tuples. Systems like Oracle, Apache Kylin, and Apache Parquet use dictionary coding.

What if you want to reconstruct the data by looking it up in the dictionary?

Even if you can unpack the integers so that the processor can get the address in the dictionary, the look-up risks becoming a bottleneck. And there is a lot of data in motion… you have to unpack the indexes, then read them back, then access the dictionary. The code might look something like this…

unpack(compressed_data, tmpbuffer, array_length, b);
for(size_t i = 0; i < array_length; ++i) {
    out[i] = dictionary[tmpbuffer[i]];
}

Surely, there is no way around looking up the data in the dictionary, so you are stuck?

Except that recent Intel processors, and the upcoming AMD Zen processors have gather instructions that can quickly look-up several values at once. In C and C++, you can use the _mm_i32gather_epi64 intrinsic. It allows you to drastically reduce the number of instructions. You no longer need to write out the unpacked indexes, and read them back.

So how effective is it? The answer, unsurprisingly, depends on the size of the dictionary and your access pattern. In my example, I assumed that you had a dictionary made of 65536 words. Such a large dictionary requires half a megabyte. It won’t fit in fast CPU cache. Because dictionary coding only makes sense for when the dictionary size is less than the main data, it would only make sense for very large data. If you have lots of data, a more practical approach might be to partition the problem so have many small dictionaries. A large dictionary might still make sense, but only if most of it is never used.

I have implemented dictionary decoding and run it on a recent Intel processor (Skylake). The speed-up from the SIMD/gather approach is comfortably a factor of two.

Number of CPU cycles per value decoded
dictionary size (# keys) scalar SIMD (gather)
512 3.1 1.2
1024 3.1 1.2
2048 3.1 1.2
4096 3.3 1.3
8192 3.7 1.7

2x is a nice gain. But we are only getting started. My Skylake processor only supports 256-bit SIMD vectors. This means that I can only gather four 64-bit values from my dictionary at once. Soon, our processors will benefit from AVX-512 and be able to gather eight 64-bit values at once. I don’t yet live in this future, so I put AVX-512 to the test on high-throughput Intel hardware (Knights Landing). Short story: you gain another factor of two… achieving a total speed-up of almost 4x over the basic code.

While the benefits are going to be even larger in the future, I should stress that benefits are likely much smaller on older processors (Haswell or before). For this work, technology is still fast evolving and there are large differences between slightly recent and bleeding-edge processors.

What is optimally fast on today’s hardware might be slow on tomorrow’s hardware.

Some relevant software:

Further reading:

Credit: Work done with Eric Daniel from the parquet-cpp project.

Instructables: exploring - featured: Gummy Bear Axe

What do you get when you cross a 5 lb bag of gummy bears, 13 oz of resin, and a wicked sharp double axe head? Sounds to me like a really bad idea...Now, the amount of new things that I did in this are just too much for me to type up easily in one Instructable. I want to apologize for that right n...
By: kludge77

Continue Reading »

Slashdot: FCC Proposes 5G Cybersecurity Requirements, Asks For Industry Advice

Presto Vivace quotes a report from FedScoop: "Cybersecurity issues must be addressed during the design phase for the entire 5G ecosystem, including devices. This will place a premium on collaboration among all stakeholders," said FCC chairman Tom Wheeler during a National Press Club event on June 20. "We continue to prefer an approach that emphasizes that industry develop cybersecurity standards just as we have done in wired networks." The FCC published a request Wednesday for comment on a new set of proposed 5G rules to the Federal Register focused on adding specific "performance requirements" for developers of example internet-connected devices. If a company hopes to secure a license to access higher-frequency 5G spectrum in the future then they will need to adhere to these specific requirements -- in other words, compliance is non-negotiable. Notably, these FCC "performance requirements" now include the submission of a network security plan. The report adds: "A quick review of the FCC's proposed 5G cybersecurity plan shows a six category split, organized by a companies' security approach, coordination efforts, standards and best practices, participation with standards bodies, other security approaches and plans with information sharing organizations. Security plans must be submitted to the commission at least six months before a 5G-ready product enters the market, according to the notice."

Read more of this story at Slashdot.

Instructables: exploring - featured: Cottage-ready Bird Feeder

Using scrap, salvaged and re-purposed wood, this bird feeder should be a big hit for the wildlife in cottage country. It can be mounted to or hung from a tree or put on stand. Within a few minutes of installing this feeder, we had chickadees, squirrels and chipmunks eating out of it! Cut wood Cut...
By: travelclimbski

Continue Reading »

MetaFilter: Not just a menu item, but a way of lunch

The Slow & Sad Death of Seattle's Iconic Teriyaki Scene (Thrillist) But new Seattle -- with the locals priced out of the area, those that remain forgetting teriyaki exists, and newcomers ignoring it -- risks losing those real shops for good. Teriyaki could be heading the direction of deep-dish... just ask a Chicagoan about it and they'll say, "Oh, that's for tourists." Teriyaki is from a different era, and it's fading as fast as traffic-free days on I-5. Since teriyaki came to town, Seattle's waved goodbye to the Kingdome, Kurt Cobain, and the Sonics. A signature stadium, a signature musician, a signature team -- and now, perhaps, a signature dish.

The Origins of Seattle Teriyaki (2007)

The point isn't that teriyaki shops are fantastic or awful—it's that they're cheap, fresh, and convenient, which is what Toshi Kasahara always intended. "I wanted to make a dish that was very affordable, so that it might be cheaper for people to come eat at my restaurant instead of making their own meal."

MetaFilter: Sail Away... Sail Away...

Because sometimes, when the stresses and hardships of earthly existence threaten to overwhelm, you just really need to see two Pokemon dancing to Orinoco Flow.

search.cpan.org: Data-Mining-Apriori-0.11

Perl extension for implement the apriori algorithm of data mining.

programming: The M/o/Vfuscator compiles C programs into "mov" instructions, and only "mov" instructions. Arithmetic, comparisons, jumps, function calls, and everything else a program needs are all performed through mov operations

submitted by /u/InaneMembrane
[link] [comments]

ScreenAnarchy: Review: HANDS OF STONE, Fleet of Foot, Light on Insight

For more than three decades after Raging Bull was released in 1980, Robert De Niro wisely stayed away from the boxing world on screen. After all, once you've appeared in one of the most spellbinding and spiritually troubling cinematic experiences of all time -- and won an Academy Award for your performance -- why tempt fate? For whatever reason, De Niro agreed to star in 2013's Grudge Match, which was more of an attempt at comedy than anything else, and now he has taken a supporting role in Hands of Stone, a biographical drama about real-life Panamanian boxer Roberto Duran, essayed by Edgar Ramirez. De Niro portrays retired trainer Ray Arcel, who worked with many notable fighters before being forced into retirement by the New...

[Read the whole post on screenanarchy.com...]

search.cpan.org: Tie-Hash-Check-0.06

Tied construct for hash key checking.

Instructables: exploring - featured: Throttle Cable Replacement on a 1975 Honda CB200T

What follows is an overview of what I learned while replacing my motorcycle's throttle cable. While I'm no motorcycle expert (yet!), I hope you can learn from my mistakes and perhaps benefit from my research, since the info on these old bikes can sometimes be hard to find. Find the Right Replaceme...
By: bekathwia

Continue Reading »

All Content: Dirty Politics May Ruin Distribution, Oscar Chances of Phenomenal "Aquarius"

Thumb_aquarius-ffc-2016-2

Brazil is going through a sad period right now.

Maybe you've read about it, maybe not, but we're in the final stage of a "soft" coup d'etat—and no, the "soft" part is no consolation at all. After 16 years of defeat to left-leaning candidates to the presidency of the country, the right-wing opposition decided that democracy was overvalued and basically conspired to impeach our first female President, Dilma Rousseff, using BUDGET ISSUES to "justify" it (even though the exact same practices were used by every president before her and by the interim president after he took the power from her). Her vice-president, by the way, not only conspired with the opposition to take her place, but also put in his cabinet the same people who were defeated in our last general elections. 

Unfortunately, a government that has no legitimacy is often an authoritarian government—and that's exactly what we've been seeing in Brazil lately. During the Olympics, for instance, people were actually ARRESTED for carrying signs against acting president Michel Temer—and this week, one of the senators working to "impeach" Dilma requested a court order FORBIDDING people to call him for what he is: a putschist. (In other words: I could be in trouble just by writing this.)

And that brings us to "Aquarius," a spectacular Brazilian film that was selected as part of the competitive slate during the last Cannes Film Festival and was actually the fifth best-evaluated by the critics of Screen Daily. Directed by Kleber Mendonça Filho (I wrote about his film "Neighbouring Sounds" for RogerEbert.com), "Aquarius" is a magnificent character study that should potentially guarantee an Oscar nomination for Sônia Braga, who offers the best performance of her long career and was lauded at Cannes this year. However, during the festival, Filho and his cast and crew protested the coup in Brazil, bringing the world's attention to what's happening here—and Temer didn't like that a bit.

Now, Temer's "government" is punishing Kleber.

At first, they flirted with the idea of firing the filmmaker from the foundation he's been administering brilliantly for more than a decade, having basically revived its film theater. After the news reverberated negatively in Brazil, they abandoned the idea. Instead, they are now trying to actually hurt the movie itself—just this week "Aquarius" got a rating of 18+ (no one less than 18 years old can watch it), which is commercially damning, as you can imagine. But "Aquarius" DOES NOT justify such a heavy rating—and, as a matter of fact, movies that were way more graphic in terms of sex and violence got considerably lighter classifications.

Interim President Temer apparently is now keen on the idea of stopping "Aquarius" from being Brazil's representative at next year's Academy Awards. In order to accomplish that, a "film critic" that has been badmouthing "Aquarius" and its director FOR MONTHS was appointed to the committee responsible for choosing the country's nominee.

Oh, and he attacked the movie and its creators without even watching it.

The "critic" in question is also a right-wing journalist who proudly supports the coup (oh, I'm sorry: the "impeachment") and is a friend of the guy appointed by Temer's government to deal with our film industry.

So, today, two very established filmmakers decided to withdraw their movies from consideration for the spot as Brazil's nominee: Gabriel Mascaro, director of the magnificent "Neon Bull," and Anna Muylaert, who was last year's choice (with the equally brilliant "The Second Mother") and was just invited by the Academy to become a member of the Director's Branch. (Muylaert withdraw her new movie, "Don't Call Me Son," which played during the 2016 Berlinale.)

The idea now is for most of the pre-candidates to be withdrawn, bringing the decision back to the hands of the artistic class and taking it away from the dirty politics of Temer and his representatives.

And that only makes sense because, at the end of the day, "Aquarius" is indeed a phenomenal movie. When you watch it without putschist filters, of course.

search.cpan.org: RPi-WiringPi-1.01

Perl interface to Raspberry Pi's board, GPIO, LCDs and other various items

ScreenAnarchy: Review: DON'T BREATHE Speeds Through Tight Turns With Wild Abandon

A muscular thriller, Don't Breathe manhandles a vaguely familiar premise into a fresh, frenzied experience. Directed by Fede Alvarez (2013's Evil Dead), the setup is brisk. Three Detroit teenagers (Jane Levy, Dylan Minette, Daniel Zovatto) have made an art out of breaking into the homes of rich people, vandalizing and looting as they go. They're in and out quick, thanks to knowledge they've secretly gained about each house and the people who live there. Levy and Zovatto are planning to move to California as soon as possible. Levy lives in a trailer park and has good reason to get out. Minette, besotted with Levy but locked in the friend zone, is the key to their success with home invasions. Zovatto is big and tough, he...

[Read the whole post on screenanarchy.com...]

Quiet Earth: First Look at Bill Paxton in Small Town Thriller MEAN DREAMS [Clip]

Director Nathan Morlando made a bit of a splash a couple of years ago with his feature film debut Edwin Boyd, a period heist movie I wasn't particularly impressed with but which suggested Morlando showed potential given the right material and with his sophomore feature, it seems he may have found his stride.


Mean Dreams, which premiered at Cannes earlier this year, stars Sophie Nélisse (a complete revelation in 2013's otherwise forgettable The Book Thief) as Casey and relative newcomer Josh Wiggins as Jonas, a pair of teenagers desperate to escape their abusive homes. They devise a plan to steal some money and try to escape their rural living only to find [Continued ...]

Open Culture: Hear the One Night Sun Ra & John Cage Played Together in Concert (1986)

It’s hard to imagine two figures more representative of two disparate directions experimental music took in the 20th century than John Cage and Sun Ra. Cage’s aleatory arrangements and instruments improvised from radios and TV sets left much to the discretion of the performer. And yet, oddly, he didn’t think much of improvisatory music, writing in his 1961 book Silence that he considered jazz “rather silly” and “unsuited,” notes Seth Colter Walls at Pitchfork, “for ‘serious’ contexts.”

Sun Ra, on the other hand, while a master improviser, left little to chance. He embraced the role of bandleader of his Arkestra with unique vigor, “completely obsessed with precision and discipline.” Cage preferred the plain-spoken, unspoken, and wordless. Ra delivered rococo treatises onstage, dressed in glittering capes and headdresses. How the two would, or could, come together may seem a mystery, but come together they did, for a one-time concert event at a Coney Island freak show.

The resulting album is “one of the most sought after records in either discography,” writes The Vinyl Factory in an announcement of the full performance’s recent release by label Modern Harmonic. Fans can finally purchase that double LP, or listen to the live recording for free above. (If you need Spotify’s software, download it here.) Though it may seem like a bit of a novelty, “the album gradually emerges as something greater than a footnote,” Walls writes, “despite the arms-length embrace, the overall concert has a surprisingly seamless quality.”

Cage’s contributions consist mainly of wordless vocalizations and poignant silences. Ra recites poetry and unleashes solo after solo on his Yamaha DX7 synthesizer, blending “sci-fi movie tones” with “sprightly figures” and “dense chords and drones.” The album’s trailer at the top of the post offers some rare black and white footage of the occasion, which briefly included a couple of additional artists–Arkestra saxophonist Marshall Allen and singer June Tyson. (Tyson’s intentionally strained performance “is beset by amplification problems,” Walls warns, “though the noise-damaged result works, in context.”


Throughout the one-off meeting, Ra and Cage trade solos, each respectfully yielding the stage to the other in turn. While this setup highlights the two giants’ profoundly different approaches to making–and conceiving of–music, Sun Ra’s “ability to meet Cage more than halfway… helps hold the entire gig together,” writes Walls. One of the few tracks on which the two collaborate directly, “Silent Duet,” is, well, exactly that. Since we cannot see the performance, we have to imagine the two of them, sitting side-by-side in silence, as the audience seems to all but hold its breath.

The odd thump of a foot against the mic stand aside, the recording documents almost total dead air. Then this gives way to Cage’s cryptic mumbling and Ra’s restrained keyboard taps in “Empty Words and Keyboard.” The effect is electric, the moment sacred, and the collaboration, though fleeting, reveals itself as genuinely inspired, not only for its careful play of contrasting avant-gardism’s against each other but for the extraordinary instances in which Afrofuturist free jazz and Fluxus minimalism find accord.

Related Content:

A Sun Ra Christmas: Hear His 1976 Radio Broadcast of Poetry and Music

Sun Ra Plays a Music Therapy Gig at a Mental Hospital; Inspires Patient to Talk for the First Time in Years

The Music of Avant-Garde Composer John Cage Now Available in a Free Online Archive

The Curious Score for John Cage’s “Silent” Zen Composition 4’33”

Josh Jones is a writer and musician based in Durham, NC. Follow him at @jdmagness

Hear the One Night Sun Ra & John Cage Played Together in Concert (1986) is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

search.cpan.org: Mojo-IRC-0.34

IRC Client for the Mojo IOLoop

Recent additions: postgresql-libpq 0.9.2.0

Added by LeonSmith, Thu Aug 25 20:36:38 UTC 2016.

low-level binding to libpq

Recent additions: hocilib 0.1.0

Added by Thierry, Thu Aug 25 20:27:07 UTC 2016.

FFI binding to OCILIB

search.cpan.org: Locale-Maketext-Lexicon-Getcontext-0.01

PO file parser for Maketext

Hackaday: A Refrigerator Cooled by Rubber Bands

Ever noticed that a rubber band gets warmer when it’s stretched? The bands also get cooler when allowed to snap back to relaxed length? [Ben Krasnow] noticed, and he built a rubber band cooled refrigerator to demonstrate the concept. The idea of stretching a rubber band to make it hotter, then releasing it to make it cooler seems a bit counter intuitive. Normally when things get smaller (like a gas being compressed) they get hotter. When pressure is released the gas gets cooler. Rubber bands do the exact opposite. Stretching a rubber band makes it hot. Releasing the stretched band causes it to get cooler.

No, the second law of thermodynamics isn’t in jeopardy. The secret is in the molecular structure of rubber bands. The bands are made of long polymer chains. A relaxed rubber band’s chains are a tangled mess. Stretching the band causes the chains to untangle and line up in an orderly fashion. By stretching the band you are decreasing its entropy. The energy of the molecules in the band don’t change, but entropy does. All the work one does to stheatwheelretch the band has to go somewhere, and that somewhere is heat. This is all an example of entropic force. For a physics model of what’s going on, check out ideal chains. If you’re confused, watch the video. [Ben] does a better job of explaining entropic force visually than we can with text.

To test this phenomenon out, [Ben] first built a wheel with rubber bands as spokes. Placing the wheel in front of a heater caused it to slowly rotate. [Ben] then reversed the process by building a refrigerator. He modeled his parts in solidworks, then cut parts with his Shaper handheld CNC. The fridge itself consists of an offset wheel of rubber bands. The bands are stretched outside the fridge, and released inside. Two fans help transfer the thermal energy from the bands to the air. The whole thing is hand cranked, so this would make a perfect museum or educational demonstration. Cranking the fridge for 5 minutes did get the air inside a couple of degrees cooler. Rubber is never going to displace standard refrigerants, but this is a great demo of the principles of entropic force.

For more thermodynamic fun, check out [Al Williams] recent article about building a DIY heat pipe.


Filed under: classic hacks

ScreenAnarchy: IRU MUGAN Trailer: Vikram Is a Dead Serious Friend and Delightfully Daft Foe

The monomymic Vikram is one of my favorite Indian actors. He has, over the course of 25 years, created an amazing body of work that is unlike anything else I can think of. He divides his time between mainstream masala performances, smaller more serious projects, and balls-out weirdo performances in a manner that demands respect. His latest film coming to cinema screens, Iru Mugan, appears to fall into the balls-out weirdo category.Over the last 15 years he has starred in big budget blockbusters as a multiple-personality disordered Jheri-curled vigilante in Anniyan, a chicken-suited superhero in Kanthaswamy, a mentally disabled father fighting to gain custody of his daughter in Deiva Thirumagal, and a bodybuilder cum hunchbacked avenger in I. There isn't much in the way of...

[Read the whole post on screenanarchy.com...]

Computer Science: Theory and Application: Records of 3,600 computer science professors at 70 top universities (US/Canada) — help us keep it up to date!

Wanted to share a computer science resource a couple of us in the HCI group at Brown have put together.

It’s a crowd-editable spreadsheet of data of ~3,600 computer science professors. For example, where they got their degrees, subfield of expertise, their join year and rank, etc...

http://drafty.cs.brown.edu

It might be useful if you’re applying to Ph.D. programs or faculty positions, seeking external collaborators, or just to better understand hiring trends in CS departments.

submitted by /u/swallis21
[link] [comments]

Perlsphere: Perl Magazine: Cultured Perl

A news from perlsphere.net: CulturedPerl community collaborative blog has been launched!
The idea is really interesting: have a nice online magazine about Perl.
I'm not a Perl expert, at least not enough to be a writer/author for such pubblication, but I will surely read on it.

ScreenAnarchy: Trailer For Japanese Sci-Fi Action Short MUGA SHOZOKU Looks Impressive

Fresh from its festival tour, Rashad Haughton's short film Muga Shozoku is getting ready to make its online debut, and we've got a very impressive looking trailer to share. Haughton may be familiar to ScreenAnarchy readers as the writer/director of 2012's Love Like Aliens, a futuristic love story that took the form of a music video with music composed by Haughton. I first saw his work at the Asian Film Festival of Dallas in 2012 and remember being very impressed. With Muga Shozoku, Haughton has moved from a fully CG experience to a mix of live action and CG to create an interesting looking film that feels similar to Japanese steampunk/future shock features like Goemon or Casshern. Muga Shozoku features a trio of leads, most of...

[Read the whole post on screenanarchy.com...]

Recent additions: dynamic-loader 0.0.1

Added by GaborGreif, Thu Aug 25 19:07:04 UTC 2016.

lightweight loader of GHC-based modules or packages

Open Culture: Hear the Music of David Lynch’s Twin Peaks Played by the Danish National Symphony Orchestra

With Twin Peaks coming back to our TV screens next year, fans want to know who’s coming back from the original cast and crew. The same could be said for composer Angelo Badalamenti, whose theme music for the series still evokes shots of sawmills, high waterfalls, rustling pines, and a deep, dark sense of mystery combined with the pangs of doomed romance.

In this selection from an August 19, 2016 concert from the Danish National Symphony Orchestra, under the baton of Anthony Weeden, Badalamenti’s score is given a chance to stand alone as a composition without the visuals. Bathed in red light, the orchestra looks appropriately Lynchian, and all that’s missing is a large red curtain and zigzag flooring. The arrangement hews close to Badalamenti’s, though his small combo from the original soundtrack gets expanded to a full orchestra, with kettledrums, glockenspiel, harp, and concert bells. However, when “Laura Palmer’s Theme” segues into the title theme, the two-note twang is still played on electric guitar. (You can’t mess with that!)

In this context, Badalamenti’s nods to Bernard Hermann’s Vertigo score are even more apparent, especially in the delicate, swelling love melody that is always in danger of sad collapse. The concert also featured selections from other great television soundtracks, including Game of Thrones, Homeland, Breaking Bad, Six Feet Under, and more. The whole concert can be watched here.

“We had a fabulous time performing it —a very special part of the evening,” Anthony Weeden is quoted as saying on the go-to Welcome to Twin Peaks site. And he added, “I can’t wait for the new series!”

Neither can we, Mr. Weeden.

via Welcome to Twin Peaks

Related Content:

Play the Twin Peaks Video Game: Retro Fun for David Lynch Fans

David Lynch Draws a Map of Twin Peaks (to Help Pitch the Show to ABC)

Hear the Music of David Lynch’s Twin Peaks Played by the Experimental Band, Xiu Xiu: A Free Stream of Their New Album

Ted Mills is a freelance writer on the arts who currently hosts the artist interview-based FunkZone Podcast. You can also follow him on Twitter at @tedmills, read his other arts writing at tedmills.com and/or watch his films here.

Hear the Music of David Lynch’s Twin Peaks Played by the Danish National Symphony Orchestra is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

Quiet Earth: First Look at Dystopic Retro Scifi DARWIN [Trailer]

Here's something that plays into the current obsession with technology: Darwin.


Directed by Benjamin Duffield, a long-time TV and movie editor who occasionally dabbles as a director, Darwin is Duffield's first feature in a number of years and it looks rather fantastic.


The movie stars Nick Krause as Darwin, a young man living in a dystopian society where the outside world has been destroyed. Darwin spends his days in front of a computer screen playing games and dreaming about girls but when his living space encounters a malfunction that leaves him without food or water, he ventures outside where he discovers a perfectly healthy world. He's obviously being lied to but to what end?


What I love most of the trailer is just how retro it feels. From the [Continued ...]

Recent additions: ginger 0.3.2.0

Added by TobiasDammers, Thu Aug 25 18:45:27 UTC 2016.

An implementation of the Jinja2 template language in Haskell

Hackaday: Arduino Versus Logic: The Coil Gun War Continues

Looks like another shot has been fired in the simmering Coil Gun Control War. This time, [Great Scott] is taken to the discrete woodshed with a simplified and improved control circuit using a single CMOS chip and a few transistors. Where will it end? Won’t somebody think of the children?

The latest salvo is in response to [GreatScott]’s attempt to control a DIY coil gun with discrete logic, which in turn was a response to comments that he took the easy way out and used an Arduino in the original build. [Great Scott]’s second build was intended to justify the original design choice, and seemed to do a good job of explaining how much easier and better the build was with a microcontroller. Case closed, right?

Nope. Embedded designer [fede.tft] wasn’t sure the design was even close to optimized, so he got to work — on his vacation, no less!’ He trimmed the component count down to a single CMOS chip (a quad Schmitt trigger NAND), a couple of switching transistors, the MOSFETs that drive the coils, and a few passives. The NANDs are set up as flip-flops that are triggered and reset by the projectile sensors, which are implemented as hardwired AND gates. The total component count is actually less than the support components on the original Arduino build, and [fede.tft] goes so far as to offer ideas for an alternative that does away with the switching transistors.

Even though [fede.tft] admits that [GreatScott] has him beat since he actually built both his circuits, hats off to him for showing us what can likely be accomplished with just a few components. We’d like to see someone implement this design, and see just how simple it can get.


Filed under: Arduino Hacks, weapons hacks

Colossal: A Behind-the-Scenes Timelapse Captures the Extraordinary Physical Labor for the New Stop Motion Film ‘Kubo and the Two Strings’

stop-1

This fantastic timelapse gives a stunning behind-the-scenes glimpse of animators working on the set of the new stop-motion film Kubo and the Two Strings. The film is the latest movie from animation studio Laika, who previously made Coraline, The Boxtrolls, and ParaNorman, and is the directorial debut of Travis Knight who worked as an animator on all of their previous films. You can watch an even longer version here, and the studio made a similar timelapse for the Boxtrolls.

stop-3

stop-2

Quiet Earth: Kate Beckinsale is Scared to Death of THE DISAPPOINTMENTS ROOM [Trailer]

The complaint that trailers generally reveal too much about a movie is a valid one and it seems with horror movies, that complaint is true more often than not. The first trailer for The Disappointments Room is a great example of a well cut trailer, offering up a great premise, a couple of different character motivations as to why what's happening is happening and then ending just before anything important is revealed.


Fingers crossed the movie is half this interesting.


Written by Wentworth Miller whose screenplay debut was none other than the extraordinary Stoker (review), The Disappointments Room stars Kate Beckinsale as Dana, a woman who moves into a new home with her husband and [Continued ...]

Professor Fish: Scoped global variables in Prolog

It just so happens that I needed global variables in some Prolog code.

In fact, I needed more carefully scoped global variables. SWI-Prolog's global variables are really global. (Well, they are thread-scoped, for what it matters.) This is not good, if you need a lot of global variables and maybe even in different parts of an application.

An uninspiring approach would be to fabricate global variable names in a manner that they are scoped internally by some name prefix. It was more fun to achieve scope by means of actually using one truly global variable to provide many scoped variables. Here is a demo:

?- logvars:get(myscope, a, X).                            
true.

?- logvars:get(myscope, a, Y).
true.

?- logvars:get(myscope, a, X), logvars:get(myscope, a, Y).
X = Y .

?- logvars:get(myscope, a, X), logvars:get(myscope, b, Y).
true .

Here is the code:

https://github.com/softlang/yas/blob/master/lib/Prolog/logvars.pro

Inlined below:

% (C) 2016 Ralf Laemmel
:- module(logvars, []).

/*
get(+S, +N, -V): Retrieve the value V of the global variable named N
and "scoped" by the global variable S. The variable N is
"automatically" created with a fresh logical variable V as initial
value.
*/

get(S, N, V) :-
atom(S),
atom(N),
( nb_current(S, _) ->
true;
nb_setval(S, _) ),
nb_getval(S, (Ns, Vs)),
varnth0(Pos, Ns, N),
nth0(Pos, Vs, V).

/*
varnth0(-Pos, ?Ns, +N): given a list Ns of atoms with a variable tail,
find the name N in Ns or, if not present, unify the first variable
position of Ns with N, and return the position as Pos. This is a
helper for get/3.
*/

varnth0(Pos1, [N1|Ns], N2) :-
atom(N1),
atom(N2),
( N1 == N2 ->
Pos1 = 0;
varnth0(Pos2, Ns, N2),
Pos1 is Pos2 + 1 ).
varnth0(0, [N1|_], N2) :-
var(N1),
atom(N2),
N1 = N2.

Open Culture: Pizza Box Becomes a Playable DJ Turntable Through the Magic of Conductive Ink

Turns out Pizza Hut is good for something…

They’ve teamed up with the printed electronics company Novalia to turn cardboard pizza boxes into playable turntables. Specializing in technology that adds touch and connectivity to everyday surfaces, Novalia has created two scratchable decks, each with controls that let you fine-tune the volume, pitch, playback, and crossfading. And it’s all done with the magic of conductive ink.

According to Live for Music, “the battery-powered box can be hooked up to a computer or phone through Bluetooth, then connected to any DJ software like Serato or DJ Pro.” Right now, the playable pizza box is only available at a few Pizza Hut locations in the UK. Above, DJ Vectra offers a primer on using the new gadget.

via Live for Music

Follow Open Culture on Facebook and Twitter and share intelligent media with your friends. Or better yet, sign up for our daily email and get a daily dose of Open Culture in your inbox. And if you want to make sure that our posts definitely appear in your Facebook newsfeed, just follow these simple steps.

Related Content:

Listen to Tree Rings Getting Played on a Turntable and Turned into Music

How to Clean Your Vinyl Records with Wood Glue

Postage Stamps from Bhutan That Double as Playable Vinyl Records

The “Amen Break”: The Most Famous 6-Second Drum Loop & How It Spawned a Sampling Revolution

Pizza Box Becomes a Playable DJ Turntable Through the Magic of Conductive Ink is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

Quiet Earth: New Look at Bigfoot Horror Comedy THE FIANCE [Trailer]

There's always a fine balance to be achieved when mixing genres successfully and horror comedy is one of those pairings that more often than not ends in failure but sometimes, when the balance is right, you get something that looks kind of like The Fiancé: a ridiculous premise that perfectly lends itself to a bit of schlock and man, it looks like a ton of fun.


Written and directed by Mark Allen Michaels, The Fiancé stars TV personality Carrie Keagan (she of Sharknado 4 and Syfy's DEAD 7) as a vacationing bride to be who is bitten by Bigfott, turning her into a monster who wants to kill everyone including her fiancé, played here by newcomer Dallas Valdez who falls somewhere between a bit player from Tommy Wiseau's The Room and Di [Continued ...]

s mazuk: Photo



Hackaday: Fine Business, Good Buddy: Amateur Radio for Truckers

Summer is the season for family road trips here in the US, and my family took to the open road in a big way this year. We pulled off a cross-country relocation, from Connecticut to Idaho. Five days on the road means a lot of pit stops, and we got to see a lot of truck stops and consequently, a lot of long-haul truckers. I got to thinking about their unique lifestyle and tried to imagine myself doing that job. I wondered what I’d do hour after long hour, alone in the cab of my truck. I figured that I’d probably just end up listening to a lot of audio books, but then I realized that there’s a perfect hobby for the road — ham radio. So I decided to see how ham radio is used by truckers, and mull over how a truck driver version of me might practice The World’s Best Hobby.

CB or Not CB

Truckers have long been associated with Citizens Band (CB) radio. A section of the 11-meter amateur radio band was set aside by the FCC in 1958 as a poor man’s business radio band, and by the 1970s CB rigs were in every truck. CB radios are still a tool that every trucker seems to have, but even with ridiculously powerful linear RF amps, CB has serious problems in the range department. With the FCC missing in action on the enforcement front, the 27 MHz band is a wild and wooly place where it’s difficult to reach out more than a few miles on a mobile.

In addition to the range issues, the conversations on CB are not exactly engaging stuff. Sure, as a trucker I’d want to know about traffic five miles ahead, or which weigh stations are open, but beyond that I couldn’t see myself getting into the typical profanity-laced tirades one seems to hear on CB. But it’s not even that, really. It’s more of the lack of technical challenge that makes CB unappealing to me. Buy CB rig, install rig, start talking on channel 19. Where’s the sport in that?

Local and Long Haul with Repeaters

Enter amateur radio. Ham radio in the long-haul trucker’s cab is a much better technical challenge. On the whole, it wouldn’t be a lot different than operating mobile like hams do every day. But most hams don’t find themselves 600 miles down the road at the end of a working day, and therein lies the challenge.

ICOMs D-Star digital system
ICOMs D-Star digital system. Source: ICOM

Most of the time, hams that operate on the go do so either on the 2-meter VHF band from 144 to 148 MHz, or on the 70-cm UHF band from 420 to 450 MHz. FM is generally the mode of choice in these bands, although there are plenty of other modes available to hams, including the increasingly popular digital modes like D-Star or System Fusion. But VHF and UHF signals have even worse propagation characteristics than CB — in general, the higher the frequency, the harder it is to achieve truly long-range communications via ionospheric skip. Even with the higher legal power limit enjoyed by hams on these bands, it’s really hard to reach out and touch someone directly past 10 miles or so.

To get around line-of-sight limitations, mobile hams usually rely on fixed repeaters. Repeaters allow hams to stay in contact over much larger areas, but there’s still a line-of-sight requirement between each mobile unit and the repeater. Repeaters linked with such protocols as IRLP extend coverage by simulcasting signals from one repeater to all the repeaters linked to it. But repeaters are expensive beasts to install and run, and so they’re spread pretty thin and generally concentrated in population centers. In the populated areas east of the Mississippi and along the west coast, VHF and UHF repeaters could work well for the trucking ham, but along the highways that ply the vast spaces of the American plains and mountains, not so much.

Another way for the trucking ham to leverage his or her ticket would be APRS. Automatic Packet Reporting System is a digital protocol that, among its many capabilities, allows hams to transmit their current location to a central network and display it on a map for any and all to see. I can see how this would be a great comfort to my family: “Look, Dad is between Rosebud and Forsyth I-94 in Montana.” And, with the proper gear, the trucking ham would be able to see the locations of other mobile hams for the chance for a quick drive-by QSO. Again, this would require access to repeaters, but it would still be a nice capability to have in the cab.

Long Range Trucking, Long Range Talking

As useful as VHF and UHF would be in the cab, the ultimate mobile ham experience has to be working on the high-frequency bands between 3 and 30 MHz. Access to the HF bands is the primary reason most Technician Class hams upgrade to General or Extra Class. HF privileges let you use frequencies that are readily refracted by the ionosphere so you can reach out hundreds or thousands of miles. Many hams work the HF bands with mobile rigs in their personal vehicles, so it’s no stretch to imagine a rolling HF-capable ham shack in the cab of a truck.

Antennas for HF are a bit of a problem for the rolling ham, though. Most fixed ham station antennas are large, ungainly affairs, necessarily so because of the long wavelengths in the HF bands, and they wouldn’t work well on a truck. But luckily, by making a few compromises from the gold standard quarter-wave dipole, mobile hams can still get HF antennas that perform well. Hamstick is the generic name for such antennas, and they’re readily available for every band from 6 to 75 meters.

truckk3
Ready to talk to the world – a remotely tunable HF antenna. Source: Hi-Q Antennas

Hams on 18 wheels have a significant advantage over their four-wheeler colleagues. Most over-the-road trucks come from the factory with plenty of places to mount antennas and radios. Plus, a big truck can sport a big antenna; a 75-meter hamstick that’ll look awkward on a Kia will blend right in on a Freightliner or Peterbilt.

And OTR trucks tend to have beefier electrical systems than passenger cars and light trucks. HF rigs pull a lot of juice – a 100-watt output ham radio will want almost all of 20 amps at 12 volts. You can easily source that kind of power in a truck, while in a passenger vehicle it takes some finagling.

So I guess my dream mobile shack would be a dual-band FM rig for local repeater work and APRS, along with a good HF rig to work DX. I’d mount a 20-meter hamstick on one mirror and a 40-meter on the other, and probably tuck a laptop in the sleeper compartment for logging and access to the WinLink system for email over HF – no need to rely on spotty truckstop WiFi coverage to stay in contact.

Oh, and I suppose I’d have to have a CB in the cab too. But that would just be for work. The ham rigs would be for fun.


Filed under: Hackaday Columns, Interest, Original Art, radio hacks

Colossal: Sponsor // Learn and save with Craftsy! One class for $19.99

AnyClass_1999

Some days are meant for creativity — and today is one of them! For the next 24 hours, you can pick up any one Craftsy class for $19.99 or less. Click here to unlock your special pricing. And don’t delay — this deal ends soon.

This offer is only available August 25 and 26, 2016. This offer is exclusive for Colossal readers, from our friends at Craftsy. One class per member. Prices are in U.S. dollars. This sale excludes classes from The Great Courses.

Colossal: Vibrant Tattoos by Peter Aurisch Incorporate Elements of Cubism and the Natural World

peter-1

Here’s a quick roundup of tattoos from the last year or so by German artist Peter Aurisch (previously) who continues to captivate with his bold application of color and thick lines that incorporate aspects of cubism. Aurisch works out of a private studio in Berlin where he also occasionally paints canvases and paints murals in the city. You can see much of his latest work on Instagram.

peter-2

peter-9

peter-8

peter-3

peter-7

peter-4

peter-10

peter-6

All Content: Thumbnails 8/25/16

Thumb_27-internet.w710.h473.2x

1.

"The Internet Isn't Making Us Dumber—It's Making Us More 'Meta-Ignorant'": New York Magazine's William Poundstone makes his case for how the Dunning-Kruger Effect explains our modern day ignorance. 

“There is now an active field of research into how the internet is changing what we learn and remember. In a 2011 experiment helmed by Daniel Wegner of Harvard, volunteers were presented with a list of 40 trivia facts—short, pithy statements such as ‘An ostrich’s eye is bigger than its brain.’ Each person was instructed to type all 40 statements into a computer. Half the volunteers were told to remember the facts. The other half weren’t. Also, half were informed that their work would be stored on the computer. The other half were told that it would be erased immediately after the task’s completion. The volunteers were later given a quiz on the facts they’d typed. Those instructed to remember the information scored no better than those who hadn’t been told to do so. But those who believed that their work would be erased scored much better compared to those who believed it would be saved. This was true whether they were trying to remember the facts or not. The conscious mind exercises little choice in remembering and forgetting. Nobody decides to forget a client’s name or to remember forever the lyrics of a detested pop tune. It just happens. The Harvard experiment’s results are consistent with a pragmatic system of memory. It is impossible to remember everything. The brain must constantly be doing triage on memories, without conscious intervention. And apparently it recognizes that there is less need to stock our minds with information that can be readily retrieved. (It may be a very long time before you need to know how big an ostrich’s eyeball is.) So facts are more often forgotten when people believe the facts will be archived. This phenomenon has earned a name—the Google effect—describing the automatic forgetting of information that can be found online.”

2.

"The Innovator: Jerry Lewis at Paramount Pictures": At American Cinematheque, Jim Hemphill explores the work of Lewis, whose films will be shown in a retrospective kicking off today at The Aero Theatre in Santa Monica, California.

“In his next and possibly best film, ‘The Ladies Man,’ Lewis extends this idea to destroy not only literary boundaries but architectural ones – virtually the entire movie, in which Lewis plays a houseboy working in a sort of dormitory for aspiring actresses and models, takes place in an elaborate set in which the camera traverses space with abandon. The choreography between the camera, the performers, and the set itself, which was meticulously designed to accommodate Lewis’ long takes and fourth-wall-shattering compositions, is executed with a steady precision that would make Stanley Kubrick or David Fincher jealous – yet I can think of no director whose work exhibits a greater sense of freedom and liberation. Lewis’ cinema represents the logical extension of the lessons he learned performing with Dean Martin; their routines were largely built around the juxtaposition of Martin’s solid professionalism as a crooner and Lewis’ gleeful love of disorder and willingness to wreak havoc on everything and everyone in his path. In his post-Martin movies as both actor and director, Lewis embodies both of these impulses. Behind the camera, he’s the consummate pro, a man capable of impeccably smooth camera moves and orderly compositions; in front of it, he’s an idiot man-child who carelessly dismantles everything the craftsman on the other side of the lens has worked so hard to construct. One of the simplest and funniest examples of this idea comes early on in ‘The Ladies Man’ during a graduation ceremony: Lewis the director establishes a gorgeously symmetrical composition of a graduating class only to obliterate it by having Lewis the actor jump out from within it like a deranged jack-in-the-box.”

3.

"African women who are redefining the art of filmmaking on the continent": Asari Ndem of Ventures Africa spotlights six trailblazers.

“In the postcolonial period, filmmaking in Africa was majorly dominated by men with very few female directors emerging – particularly in the realm of feature-length fiction filmmaking – but that has changed. Luckily, the women who have just started venturing into the filmmaking industry, particularly in Nigeria, have faced very little to no resistance as Omoni Oboli said ‘when I got back into the industry in 2009, I am happy people welcomed me with open hands.’ This shows that the sector is open and moving forward, regardless of the number of people within it practically doing the same thing. In the world today, women make up less than 10 percent of film directors and less than 15 percent of screenwriters internationally. However, as Nollywood takes centre stage at the Toronto International Film Festival this year, with 8 Nigerian films premiering during its City to City Spotlight on Lagos, there isn’t a better time to showcase some of the African women in filmmaking who have redefined the art of storytelling and those who still are.”

4.

"Terrence Malick's American Genesis: 'The New World'": A wonderful essay from Brice Ezell at Pop Matters.

“The queries Malick makes the foundations of his cinema are the makings of many a graduate philosophy seminar, but as he sees it, film is uniquely able to wrestle with the great dilemmas of human existence. This philosophical inquisitiveness is part and parcel of ‘The New World.’ The equivocation in the title of the film is that it’s not, at its base, about the colonization of the North American continent by the English in the 17th century. Malick’s camera is pointed at a more fundamental question: ‘How are new worlds formed?’ One can envision ‘The New World’ as a zoomed-in version of the creation sequence in Malick’s ‘The Tree of Life’: whereas the latter traces the whole cosmos as it unfolds, the former is a document of a world within a world coming to being. This approach to the Pocahontas story is where Malick also comes closest to erring where so many storytellers have erred before: whitewashing British colonization. Too often, stories about John Smith and his ilk peddle falsehoods about white saviors and uncivilized ‘savages.’ Malick gives us glimpses into the horror that would later escalate into genocide of Native American tribes: bloody fights break out, crop fields are burned, people remain perpetually lost in translation. The first shot of a British colonizer walking onto American land starts off with a sickle poking into the frame before the audience can even see the soldier carrying it. The weapon precedes the person.”

5.

"Our Diversity Isn't Looking Very Diverse": According to Etienne Rodriguez of Affinity Magazine.

“Look alive, True Believers, if the rumors are to be believed, then Zendaya is playing the role of Mary Jane Watson in the upcoming Spider-Man movie. This is the latest in a series of black women being cast in traditionally white comic book roles. First it was Candice Patton being cast as Iris West in CW’s ‘The Flash,’ then Tessa Thompson as Valkyrie in Marvel’s ‘Thor: Ragnarok,’ followed by Kiersey Clemons being cast in Warner Brother’s ‘The Flash,’ and now Zendaya. While they’re all great actresses and I can’t wait to see them in action, it’s hard not to notice that only a certain type of black girl is being cast. We all want to celebrate the fact that black women are getting more roles, but we need to address the colorism in these casting.  Zendaya, Kiersey, Tessa, and Candice are all lightskin black women. These aren’t coincidences; these are products of our society’s devaluing of darkskin black women, especially those that don’t meet Eurocentric beauty standards. These actresses received/continue to receive a lot of hate, doused in racism no doubt, but nothing in comparison to what Leslie Jones went through just last month.”

Image of the Day

The Guardian's Sian Cain presents the fairytale sculptures of writer-illustrator Shaun Tan, including the image posted above of "Hansel and Gretel."

Video of the Day

What Makes a Great Boxing Movie? from Fandor Keyframe on Vimeo.

Master editor Nelson Carvajal asks, "What makes a great boxing movie?" in his latest essential video essay at Fandor.

Disquiet: Disquiet Junto Project 0243: Synth Trial

voightk

Each Thursday in the Disquiet Junto group, a new compositional challenge is set before the group’s members, who then have just over four days to upload a track in response to the assignment. Membership in the Junto is open: just join and participate. A SoundCloud account is helpful but not required. There’s no pressure to do every project. It’s weekly so that you know it’s there, every Thursday through Monday, when you have the time.

This project was posted in the morning, California time, on Thursday, August 25, 2016, with a deadline of 11:59pm wherever you are on Monday, August 29, 2016.

These are the instructions that went out to the group’s email list (at tinyletter.com/disquiet-junto):

Disquiet Junto Project 0243: Synth Trial
The Assignment: Share the best track from your audition tape for Blade Runner 2.

Please pay particular attention to all the instructions below, in light of SoundCloud having closed down its Groups functionality.

Big picture: One thing arising from the end of the Groups functionality is a broad goal, in which an account on SoundCloud is not necessary for Disquiet Junto project participation. We’ll continue to use SoundCloud, but it isn’t required to use SoundCloud. The aspiration is for the Junto to become “platform-agnostic,” which is why using a message forum, such as llllllll.co, as a central place for each project may work well.

And now, on to this week’s project.

Project Steps:

Step 1: As you now know, Jóhann Jóhannsson was selected to score Blade Runner 2. The news means, among other things, that you didn’t get the gig. Please reconcile yourself with this.

Step 2: Please share your favorite track from the audition tape you sent to Ridley Scott.

Five More Important Steps When Your Track Is Done:

Step 1: Per the instructions below, be sure to include the project tag “disquiet0243” (no spaces) in the name of your track. If you’re posting on SoundCloud in particular, this is essential to my locating the tracks and creating a playlist of them.

Step 2: Upload your track. It is helpful but not essential that you use SoundCloud to host your track.

Step 3: This is a fairly new step, if you’ve done a Junto project previously. In the following discussion thread at llllllll.co post your track:

http://llllllll.co/t/disquiet-junto-project-0243-synth-trial/4288

Step 4: Annotate your track with a brief explanation of your approach and process.

Step 5: Then listen to and comment on tracks uploaded by your fellow Disquiet Junto participants.

This project was posted in the morning, California time, on Thursday, August 25, 2016, with a deadline of 11:59pm wherever you are on Monday, August 29, 2016.

Length: The length is up to you. Three minutes seems like a good maximum.

Title/Tag: When posting your track, please include “disquiet0243” in the title of the track, and where applicable (on SoundCloud, for example) as a tag.

Upload: When participating in this project, post one finished track with the project tag, and be sure to include a description of your process in planning, composing, and recording it. This description is an essential element of the communicative process inherent in the Disquiet Junto. Photos, video, and lists of equipment are always appreciated.

Download: It is preferable that your track is set as downloadable, and that it allows for attributed remixing (i.e., a Creative Commons license permitting non-commercial sharing with attribution).

Linking: When posting the track online, please be sure to include this information:

More on this 243rd weekly Disquiet Junto project — “Share the best track from your audition tape for Blade Runner 2” — at:

http://disquiet.com/0243/

More on the Disquiet Junto at:

http://disquiet.com/junto/

Subscribe to project announcements here:

http://tinyletter.com/disquiet-junto/

Project discussion takes place on llllllll.co:

http://llllllll.co/t/disquiet-junto-project-0243-synth-trial/4288

There’s also on a Junto Slack. Send your email address to twitter.com/disquiet for Slack inclusion.

: Yixing inventory #8: Tiehuaxuan Jiangji

This pot is one of the ones I use most heavily. I got this for a song because its handle was glued back on, but the gluing job was obviously very well done and there’s been no problem. The lion is quite detailed. The pot is stamped “tiehuaxuan zhi”. Tiehuaxuan is the name of a company during the Republican period making yixing pots, specializing especially in smaller pots (lion or shuiping) that have calligraphy and carving on them, like this one. They also make whole sets including pitchers and cups, but those get expensive. The seal under the lid is “Jiangji” referring, probably, to the maker Jiang Anqing who is known for making lion pots. 115ml.

 photo IMG_8204.jpg

 photo IMG_8205.jpg

 photo IMG_8206.jpg

 photo IMG_8207.jpg

 photo IMG_8208.jpg

OUR VALUED CUSTOMERS: What goes around comes around...


Perlsphere: Maintaining the Perl 5 Core: Report for Month 34

Dave Mitchell writes:

I spent last month mainly working on "fuzzer" bug reports, and trying to process some of the backlog in my p5p mailbox.

Summary

1:45 "Confused by eval behavior" thread
1:21 [perl #127834] @INC issues
1:26 [perl #128241] Deprecate /$empty_string/
2:03 [perl #128253] Assert fail in S_find_uninit_var
1:19 [perl #128255] Assert fail in S_sublex_done
0:26 [perl #128257] Segfault in Perl_gv_setref
0:14 [perl #128258] Segfault due to stack overflow
3:16 fix build warnings and smoke failures
8:46 process p5p mailbox

20:36 Total (HH::MM)

As of 2016/07/31: since the beginning of the grant:

146.0 weeks
1988.7 total hours
13.6 average hours per week

There are 411 hours left on the grant (it having just been extended by 400 hours).

Open Culture: Take a Virtual Reality Tour of the World’s Stolen Art

A museum which contains only works of art that nobody can find sounds like something Jorge Luis Borges would’ve dreamed up, but it has twice become a reality in the 21st century — or twice become a virtual reality, anyway. “The Concert by Johannes Vermeer. Poppy Flowers by Vincent van Gogh. Rembrandt’s The Storm on the Sea of Galilee. These are some of the world’s most famous and expensive paintings ever stolen,” writes Fast Company‘s Mark Wilson. And though their whereabouts remain unknown, you can see them at The Museum of Stolen Art, “a virtual reality exhibition created by Ziv Schneider, a graduate student at Tisch ITP, that puts stolen works back on display.”

museum of stolen art

At the moment, Schneider’s project exists on Google’s virtual reality platform Cardboard, and you can download it as a smartphone app for iOS or Android. Its current exhibits include “a collection of photographs listed as stolen in the FBI’s art crime database”; the private collection of Ferdinand and Imelda Marcos, former president and first lady of the Philippines, now “being searched for by the PCGG – a Philippine government office in charge of seizing the Marcos’ ill gotten wealth and bringing it back”; and “a large collection of paintings stolen in some of the world’s most famous art heists, including the Stewart and Isabella Gardner Museum in Boston.”

But even before Schneider’s institution opened its virtual-reality doors, writes The Creators Project’s Becky Chung, “halfway across the world another institution — also called the Museum of Stolen Art — was debuting its gallery exhibition of works currently reported stolen or missing.” This Museum of Stolen Art, in the Netherlands, presents the Poppy Flowers and Waterloo Bridges of the art world in not virtual but augmented reality: its visitors raise their phones or tablets up to its meaningfully empty walls, and on their screens see the purloined works restored to their rightful frames. William Gibson, in some sense the Borgesian visionary of our tech-saturated time, has described augmented reality as the natural evolution of virtual reality. It’s made virtual art recovery possible; can virtual art theft be far behind?

museum of stolen art 3

Reminder: You can download The Museum of Stolen Art smartphone app on iOS and AndroidThe app is ideally designed for those with a Google cardboard viewer.

Related Content:

1.8 Million Free Works of Art from World-Class Museums: A Meta List of Great Art Available Online

Visit The Museum of Online Museums (MoOM): A Mega Collection of 220 Online Exhibitions

The British Museum Is Now Open To Everyone: Take a Virtual Tour and See 4,634 Artifacts, Including the Rosetta Stone

Take a Virtual Tour of the 1913 Exhibition That Introduced Avant-Garde Art to America

Take a 3D Virtual Tour of the Sistine Chapel, St. Peter’s Basilica and Other Art-Adorned Vatican Spaces

Take a Virtual Tour of Hieronymus Bosch’s Bewildering Masterpiece The Garden of Earthly Delights

What Are the Most Stolen Books? Bookstore Lists Feature Works by Murakami, Bukowski, Burroughs, Vonnegut, Kerouac & Palahniuk

Based in Seoul, Colin Marshall writes and broadcasts on cities and culture. He’s at work on a book about Los Angeles, A Los Angeles Primer, the video series The City in Cinema, the crowdfunded journalism project Where Is the City of the Future?, and the Los Angeles Review of Books’ Korea Blog. Follow him on Twitter at @colinmarshall or on Facebook.

Take a Virtual Reality Tour of the World’s Stolen Art is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

Planet Haskell: Brandon Simmons: Announcing: unagi-bloomfilter

I just released a new Haskell library called unagi-bloomfilter that is up now on hackage. You can install it with:

$ cabal install unagi-bloomfilter

The library uses the bloom-1 variant from “Fast Bloom Filters and Their Generalization” by Yan Qiao, et al. I’ll try to write more about it when I have the time. Also I just gave a talk on things I learned working on the project last night at the New York Haskell User Group:

http://www.meetup.com/NY-Haskell/events/233372271/

It was quite rough, but I was happy to hear from folks that found some interesting things to take away from it.

Thanks to Gershom for inviting me to speak, for my company Signal Vine for sponsoring my trip out, and to Yan Qiao for generously answering my silly questions and helping me understand the paper.

P.S. We’re hiring haskell developers

Signal Vine is an awesome group of people, with interesting technology and problems to solve, and we’re looking to grow the small development team. If you have some experience with haskell (you don’t have to be a guru) and are interested, please reach out to Jason or me at:

brandon@signalvine.com
jason@signalvine.com

Saturday Morning Breakfast Cereal: Saturday Morning Breakfast Cereal - Life as a Berserker



Hovertext:
On the plus side, the afterlife plan is pretty solid.

New comic!
Today's News:

Planet Lisp: Zach Beane: Dinosaur and Lisp

Dinosaur and Lisp has a nice hack for automating the Chrome dinosaur game with Common Lisp and CLX.

programming: The target="_blank" vulnerability by example

submitted by /u/bhalp1
[link] [comments]

All Content: Southside With You

Thumb_southside-with-you-2016

As Michelle Robinson (Tika Sumpter) gets dressed in her home on the South Side of Chicago, her mother (Vanessa Bell Calloway) playfully teases her about the amount of effort Michelle is putting into her appearance. “I thought this wasn’t a date,” she chides. Michelle insists it isn’t. “You know I like to look nice when I go out,” she says. When her father joins his wife in ribbing their daughter, Michelle digs in her heels about this being a “non-date”. But it’s clear the lady doth protest too much. In her mind, there’s no way she’s falling for the smooth-talking co-worker who invited her to a community event. She’s seen this type of brother before, and she thinks she’s immune to his brand of charm.

Soon, the brother in question, Barack Obama (Parker Sawyers), picks up Miss Robinson. Our first glimpse of him, backed by Janet Jackson’s deliriously catchy 1989 hit “Miss You Much," is a master class of not allowing one’s meager means to interfere with one’s confidence level. Barack smokes with the preternaturally efficient coolness of Bette Davis, yet drives a car built for Fred Flintstone. The large hole in the passenger side floor of his raggedy vehicle will not diminish his swagger nor derail his plan. Using the community event as a jumping-off point, he intends to gently push this non-date into the date category.

So begins the romantic comedy "Southside with You," a mostly-true account of the first date between our current President and the First Lady. Like “Before Sunrise,” a film which invites comparison, “Southside with You” is a two-hander that's top-heavy with dialogue, walking and a knowing sense of location. Unlike that film, however, we already know the ending before the lights go down in the theater. So, writer/director Richard Tanne replaces the suspenseful pull of “will they or won’t they?” with an equally compelling and understated character study that humanizes his larger-than-life public figures. Tanne reminds us that, before ascending to the most powerful office in the world, Barack and Michelle were just two regular people who started out somewhere much smaller.

This down-to-earth approach works surprisingly well because “Southside with You” never loses sight of the primary tenet of a great romantic comedy: All you need is two people whom the audience wants to see get together—then you put them together. So many entries in this genre fail miserably because the filmmakers feel compelled to overcomplicate matters with useless subplots and extraneous characters; they mistake cacophony for complexity. “Southside with You” builds its emotional richness by coasting on the charisma of its two leads as they carefully navigate each other’s personality quirks and life stories. We may be ahead of them in terms of knowing the outcome, but we’re simultaneously learning the details.

“Southside with You” is at once a love song to the city of Chicago and its denizens, an unmistakably Black romance and a gentle, universal comedy. It is unapologetic about all three of these elements, and interweaves them in such a subtle fashion that they become more pronounced only upon later reflection. The Chicago affection manifests itself not only in a scene where, in front of a small group of community activists welcoming back their favorite son, Barack demonstrates a rough version of the speechmaking ability that will later become his trademark, but also when Barack takes Michelle to an art gallery. He points out that the Ernie Barnes paintings they’re viewing were used on the Chicago-set sitcom “Good Times.” Then the duo recite Chicago native Gwendolyn Brooks’ poem about the pool players at the Golden Shovel, "We Real Cool." Even the beloved founder of this site, Roger Ebert, gets a shout-out for championing “Do the Right Thing," the movie Barack and Michelle attend in the closing hours of their date.

Though its depiction of romance is recognizable to anyone who has ever gone on a successful first date, “Southside with You” also takes time to address the concerns Michelle has with dating her co-worker, especially since she’s his superior and the only Black woman in the office. The optics of this pairing worries her in ways that hint at the corporate sexism that existed back in 1989, and continues in some fashion today. Her concern is that her superiors might think she threw herself at the only other Black employee which, based on my own personal workplace experience, I found completely relatable. This plotline has traction, culminating in a fictional though very effective climactic scene between Barack, Michelle and their boss. It’s a bit overdramatic, but the payoff is a lovely ice cream-based reconciliation that may do for Baskin-Robbins what Beyoncé’s “Formation” did for Red Lobster.

Heady topics aside, “Southside with You” is often hilarious and never loses its old-fashioned sweetness. Sumpter’s take on Michelle is a tad more on-point than Sawyers’ Barack, but he compensates by exuding the same bemused self-assurance as his real-life counterpart. The two leads are both excellent, but this is really Michelle’s show. Sumpter relishes throwing those “you think you’re cute” looks that poke sharp, though loving holes in all forms of braggadocio, and Sawyers fills them with surprising vulnerability. The two manage to create a beautiful tribute to enduring love in just under 90 minutes, making “Southside with You” an irresistibly romantic and rousing success.

All Content: Don't Breathe

Thumb_dont-breathe-2016

At its best, Fede Alvarez’s “Don’t Breathe” is a tight, confined thriller—the kind of morality play that toys with audience loyalty and works to convey its protagonists' predicament by making us feel claustrophobic right alongside them. For long passages, the movie plays out in real time, and Alvarez and his team have a remarkable sense of film geography, established in a beautiful unbroken shot that defines the space for this largely one-setting exercise in terror. Alvarez was also wise to reunite with “Evil Dead” star Jane Levy, an actress who can do a lot with very little in terms of character development and is remarkably fearless physically, and even wiser to cast Stephen Lang, a fantastic character actor for decades who has been given one of his most memorable roles here. Like a lot of films of this breed, “Don’t Breathe” gets a little less interesting as it proceeds to its inevitable conclusion, replacing tension with shock value, but it works so well up to that point that your heart will likely be beating too fast to care.

Rocky (Levy), her boyfriend Money (Daniel Zovatto) and wishes-he-was-boyfriend Alex (Dylan Minnette) rob houses in the wealthy suburbs of Detroit. Alex’s dad manages a security company and therefore has access to keys that allow for a lot less “breaking” in breaking & entering. Rocky has a horrible mother and a baby sister that she’ll do anything to get out of their dysfunctional and dangerous home. Tired of quickie jobs that net a few nice watches and some jewelry, Money stumbles on a possible crime that would truly change their lives. Deep in the desolate, rundown heart of Detroit—on one of many blocks with no neighbors and few active utilities—lives a blind man (Lang). A few years earlier, his daughter was killed in a car accident and he received a massive cash settlement that Money believes is in a safe in the house. Rocky, Money and Alex will just go in and take it. He’s a blind veteran who lives alone. How hard could it be?

The men of “Don’t Breathe” are given almost no defining character traits whatsoever, and that’s to the film’s detriment. You can feel Alvarez rushing to get to the centerpiece when he could have taken a beat or two to give us a reason to care about Money and Alex beyond the former being a tough guy and the latter being the nice one. Rocky/Levy fares a little better, as the actress imbues a few very short scenes with a palpable dose of urgency. She doesn’t rob for profit or need; she is stealing money that’s just sitting in a safe to save her life and that of her sister. She’ll get the cash, they’ll all flee Detroit to California, and everyone will live happily ever after. The complex morality of Rocky’s dilemma is one of the most interesting narrative elements of “Don’t Breathe.” In theory, we shouldn’t be rooting for a young lady to steal money from a blind man, but we do.

And that moral complexity takes a sharp turn when things go wrong in the main event of “Don’t Breathe.” Without spoiling nearly as much as the previews do, let’s just say that these three low-level criminals vastly underestimate both the current situation in their target’s home and its resident’s certain set of skills. The MVP of this midsection is arguably cinematographer Pedro Luque, who works with Alvarez to very clearly define the blueprint of the house and where our characters are within it. Unlike a lot of modern horror, which uses quick cuts and shaky camerawork to induce fear, Alvarez and Luque understand that we’ll relate to the predicament of “Don’t Breathe” the more clearly we can define what’s going on. As Lang and Levy play a game of cat and mouse through this maze, it’s best to know where the walls are. And, of course, it’s more effective when Alvarez and company pull those walls away in a basement that feels like a neverending series of shelves, replicating the protagonist’s confusion and fear.

There’s a significant twist in “Don’t Breathe” (again, don’t watch the previews) that produces shock value (and allows for even more disturbing material later on) but it almost feels like a misstep in that it pushes Lang’s character towards a definitive villain role. I like the idea of a battle of wills—in a home within an abandoned neighborhood—between characters that occupy grayer areas in terms of morality. There are also a few plot turns in the final act that require more suspension of disbelief. 

At the heart of the film, as young people who made a very bad decision try to survive long enough to get out of a house that has turned into a fortress, “Don’t Breathe” is tense and even relatable. There are millions of young people, especially in Detroit, trying to escape their bad decisions. “Don’t Breathe” becomes a battle of wills between two people who have done very bad things but justified their actions to themselves. The talented Levy and Lang allow us to understand their characters' polarizing choices, and place us right there in the house—with the petty criminal and the man with the dark secret, holding our breath. 


All Content: Everything's Manipulated, but to What End?: Robert Greene on "Kate Plays Christine"

Thumb_kpc-rg-2016-4

After eight months of successful (and sometimes contentious) premieres at film festivals around the globe—including Sundance, where it took home a prize for writing—Robert Greene's film “Kate Plays Christine” opens this weekend at the IFC Center in New York City. Greene is known for his genre-pushing nonfiction films like “Actress” and “Fake It So Real”; in his latest, actress Kate Lyn Sheil travels to Sarasota, Florida to prepare to play Christine Chubbuck, the newscaster who killed herself on-air in 1974. As Kate does research and transforms herself into Christine, however, the film raises questions about why and how we tell and watch stories like Chubbuck's.

Greene spoke with RogerEbert.com at the True/False Film Festival in Columbia, Missouri last March for a long, winding conversation about his films, nonfiction, criticism, editing, and honesty. (Greene lives in Columbia, where he serves as the filmmaker-in-chief at the Murray Center for Documentary Journalism at the Missouri School of Journalism.) 

This transcript was edited for length and clarity.

You've written and talked a lot about the ways documentary filmmaking is changing. Does a documentary have to be “real”?

Some students that I've talked to really cling to the idea that if it's authentic and real, then it's a documentary. But what about reality TV? You know that's manipulated, but it's still based on reality. Just think of documentaries as a less horrible version of reality TV. That's a starting place. That's what documentary is.

When you sit down for a documentary, you're suspicious. The documentary's job is to convince you of its own authenticity, because somewhere in your head—whether it's because of reality TV, or whether you're a skeptical person, or whether you just don't trust the idea—you’re thinking, Well, it says it's real. 

Some people think the opposite. Some people think [audiences] are naïve, that they sit down and think, This is real. I think there's some truth to that, too. But there's still a nugget of suspicion in the back of most viewers' minds. Let me use that as a starting place to go inside the mind of someone else in a way that it's hard to do, in any form of art. 

I'm really making “Kate Plays Christine” for people who sit down and say, "I know this isn't real. But I want it to be real, because I'm being told it's a documentary. What does that mean?" I don't think everybody who watches the movie needs to have that active in their head. But that's my optimal viewer. You're just making movies you want to see, and that's how I view these things.

I did my MFA in creative nonfiction writing, and wound up mostly realizing that difference between fiction and nonfiction is that with fiction, you know the story isn't in your own space-time continuum; with nonfiction, you expect that it is in your space-time continuum.

I think when you sit down, you're like, Is this made up, or does it exist in the world that I live in? That's a beautiful delineation. I really reject people saying there is no difference [between fiction and nonfiction]. I think there absolutely is a difference—but I think it's an art-perspective difference, not an ownership-of-truth difference. To me, when you sit down at a documentary, you expect that what you're going to experience is what the filmmaker experienced and that was not in their control. That's the expectation. It's an out-of-control feeling.

For this movie, the concept is very much in control. Kate [Lyn Sheil] is actually very much in control. She's delivering a performance which hints at and uses her own out-of-controlness, but uses it in a controlled way. She's an incredible performer who was using her own doubts about the process, her own doubts about me, her own doubts about herself, her own feelings about Christine Chubbuck to create a version of a performance. 

Yet the film itself flows in a way that was completely based on what we're experiencing, and that's why I cling to nonfiction for it. I would've never written that ending. That ending couldn't be written by me. That ending was partly written by Kate, and partly just happened. It's ironic that we got this writing award at Sundance because I did so little writing, on purpose; I don't like writing.

What was written, going into it?

Like almost any documentary, we write out what you imagine the film to be. You know that you're going to deviate wildly from that. In this case, it was a list of ideas. The dialogue of the recreations, the dramatization of [Chubbuck's] life, are all strictly taken from public record, so that was written in a sense, but it was also just adapted from what we knew. There's one or two times it goes off that track, but as much as we could we really stuck to it.

Take the scene with Kate as Christine and the actress playing Christine's mother, as they're sitting on the couches. That's not a matter of public record, right? Is that imagined?

That scene is based on a couple lines she said to her mother. We improvised from those lines, but what you see is frustration, because it wasn't enough. That was legitimate frustration. Kate was also playing up the frustration, which I didn't even know at the time. The construct was that we can only start from this tiny bit of information, and they got frustrated as actors would, and I recorded the frustration.

When you were in the moment, how much did you know whether what you were watching was “real”? 

The concept was set up, so I would say, "We're going to do a scene where you're wearing a wig and you go through differences between you and Christine." So she does it. What's the artificial part of that? The artificial part of it is an interview—so it's not any more or less artificial than any other [interview in another] documentary. I had Kate put the wig on; that was an artificial thing. That's not something she would've chosen to do. In the middle of it, she lashes out and says, "I would be doing this this way if we weren't doing it for the cameras." 

So, there you have three layers of artificiality. I wanted basically every scene to be collapsing those things constantly into each other. Not just to be like, "I don't know what's real or not," but because what Christine Chubbuck did was performative. This is difficult to try to articulate, but the relationship between her internal life, which we can't know, which was depressed and dealing—she was very ambitious, and she was dealing with a ton of things we can't know. So her final act can be understood through thinking of it as performance. How do you perform this thing for the world?

My idea was that there's a gulf between the real and the performed. We dive into this invisible dark hole that you can't know. That's what the movie is. Questions like, “Is it real? Is it not?” are meant to put you in a psychological space, questioning what you're seeing, questioning how someone might think about what you're seeing, questioning what Kate's thinking, or what Christine would've been thinking.

I'm attracted probably to the same things you are in postmodernism, which is the idea that truth is a movable thing. To me, that's very interesting in 1974 [when Christine Chubbuck died]. I want to take that instinct of questioning, and this postmodern idea, and make it cinematically meaningful.

That seems extra significant now, because people keep writing about how we're living in world full of cameras, and we perform for them. We take selfies, and all that. 

And that's what we understand nonfiction to be now. If you were just making a observational documentary about something, I think if your audience is an audience of selfie-makers, there is potential for them to say, "This is all bullshit," or, "How am I supposed to connect to this?"

Documentaries are obviously in constant conversation with the culture that's creating the documentaries. We're in a time now where people are aware of that mechanism, of the performance aspect of their own lives. You can then take that as your starting place, as a sort of soup that they understand. Let's start from the place we all understand, and make something about something else. 

You've been critical of HBO's "The Jinx." I ended up watching all of it after it had aired. My college students didn't seem bothered at all by the idea that the footage was manipulated. To them it was like, "Of course it is!" Other people lost their minds, like, "Did you know that sometimes documentarians mess with things?"

The nature of the form is there's a tension between manipulation and what really happened. That's the thing. That implies that there's always manipulation. Absolutely true. In the Maysles there's always been manipulation. Frederick Wiseman claims he doesn't get performances, which is absolutely ludicrous, but I don't think he understands what performance means. We're seeing people at welfare office perform their jobs, and that's welfare. 

But what does the manipulation lead to? What is the fabrication about? For me, "The Jinx," and things like it, want to make addictive television. Addictive television is not anti-art, but it's not what I'm interested in. I'm not uninterested in watchability, and I'm not uninterested in tension on screen; these are things I crave and desire and want to do myself, to make something that someone can't take their eyes off of. I completely understand that instinct. But there's a cheapness that can happen when the manipulations aren't there to challenge, but to put all of it in a box so you understand it better, not to make you question everything you're seeing. Those are two different instincts.

Everything's manipulated, but to what end? What are you doing it for? If you're just manipulating because you don't give a fuck about the reality of the situation, or because you want to make something more dramatic, or whatever, that's problematic. 

Memoir writers talk about this all the time, too, because you always have to conflate people, you have to alter details. And how do you do it? Can we talk about the morality of that? 

It's bullshit. Janet Malcolm's The Journalist and the Murderer is my favorite book for a reason: there is a ravenous, vulturous quality to interviewing anyone and turning them into a character for you. Documentary's highest nature is still exploitative. You could shade that in one direction or another and say, "Exploitative sounds cynical." I don't mean it cynically at all. I mean it like, let's just lay the cards on the table so that we can actually make interesting, meaningful, powerful films. That's just the truth. 

But that doesn't imply the subject has no power. For my last two films, that's been a pleasure: working with an actor, because I'm no less an exploiter, but I'm working with someone who's aware.

Who's used to it.

Who's used to it, and who is able to take that power exchange and turn it into something productive. [In "Actress"], Brandy Burre was certainly able to do that. Kate is a master at doing that in this film. The film is ours. It's not mine. I made the concept; she's very polite about it and will say, "It was all Robert's idea." But there's no film without her, and without Sean Price Williams who shot the film, and Bennett Elliott who produced it. They believed in my concept. My whole job was fighting for the concept to stick, because I'm also the editor. I have another hat. 

But working with an actor allows for an exploration of that concept, on a heightened level. I'm not exploiting a person in the same way.

Actors are used to having the camera trained on them.

Actors create. When people think about performance and acting, they often think falsity, or contrivance, or lying. What actors are really doing is projecting, creating a thing to look at. But they're not always in control. If they were always in control, that would suck. There's always a mix of documentary and fiction in every performance. Kate's performance is a marvel at this—she's able to make you think everything at once. You're thinking that's really her; you're thinking this is a complete performance; you're thinking she's got Christine Chubbuck; you're thinking she'll never understand Christine Chubbuck—all at once. That's not me. That's me knowing how to work with someone who's doing most of the work.

It's not dissimilar to what Janet Malcolm is doing in The Journalist and the Murderer. 

I was thinking about Janet Malcolm the whole time.

She articulated an idea that everyone knows to be true: you're only as good as your interviewee. You could be brilliant, but you're only as good as that person's willing to come to you. All documentary's the same. When you add an actor to that scenario, it heightens that whole question.

Have you read Forty-Two False Starts?

Yeah. What a great title.

In the title essay, she just keeps trying to rewrite the beginning of this article about this artist. She can't get a handle on it, and what she discovers as she rewrites it over and over is that he's performing for her as much as she's performing as she writes his piece as a writer.

I want to make a movie with her.

Can I ask you about criticism? You write some criticism, and both "Kate Plays Christine" and "Actress" feel like critical essays, in a sense. Do you see those two things feeding into one another?

The lines between critic and filmmaker are really blurry. Especially when you're editing. My favorite thing to do is to come on a film when it's in a rough cut stage and take it to the finish line. It's criticism two steps earlier—that's how I think of it. In both editing and criticism, you're basically assessing the thing and prescribing your opinion about it. 

But also, I care about the medium a lot. I care about nonfiction. I think it's incredibly vibrant. As an art form it's like there's the endless possibilities. There's obviously endless possibilities in fiction, and there's endless possibilities in all art forms, but nonfiction is the one that's most exciting to me.

It's still pretty untapped.

At the same time, the traditional cinematic nonfiction goes back to the Lumière brothers. It's untapped because documentary at some point in the 80's became seen as instructional manuals for an issue, or a replacement for classical ideas of journalism. 

But you can pick out a masterful film made every single year since the dawn of movies that would be a great example of “blurring the lines” between fiction and nonfiction. All of the great literary filmmakers understand this. 

Because it has a misunderstood, or under-understood history, there's so much to talk about—especially because there are so many great films adding to that tradition every year now, because it's easier to make a film, because we can afford cameras. That's the reason that's why I write about it. I don't write because I think I have authority; I write because I'm excited. I write because I started writing thinking I needed to explain what I was hoping to do with “Actress” to the world. The writing and “Actress” were absolutely one thing. You're right to pick up on that as a sort of critical essay film—they're both the same. For both “Actress” and “Kate Plays Christine,” I want to take the questions, the excitement, and put it on screen, rather than run away from it. Most documentaries are running away from the actual tensions of the form. 

So what was a tipping point, where many more people started thinking about documentaries and nonfiction filmmaking in a different way?

The Act of Killing” was the tipping point. I really believe that. “The Act of Killing” and “Leviathan” basically came out at the same time. Many more people saw “The Act of Killing,” but they're both tipping points about what documentaries are. ["The Act of Killing" director Joshua] Oppenheimer claimed so many different possibilities for what nonfiction can be. Can it change the world? Yes. Can it be political? Yes. Can it be a piece of journalism? Yes. Can it be a piece of art? He did all of it, and he did all of it masterfully, in “The Look of Silence” as well. “The Act of Killing” will be a moment that we look back to. Whether films were happening before or after doesn't matter because that one's the one that took a moment and did it.

Being in the U.S. Documentary Competition at Sundance with a movie like “Kate Plays Christine” is a sign that I'm not nearly as radical as I think I am, and that's awesome. I don't want to be radical. I want everyone to talk about this stuff. I don't want to be avant garde. I want a large amount of people to watch movies, and be excited by the ideas, and get dragged into the story, just like they were dragged into some Scorsese movie in the 80s. It's not about doing it in a vacuum; I want to be loud. Maybe we're at the moment.

It also makes me think we've got to push further, because there's so much more to do, and there's so much more to explore.

I wonder, given the memoir boom in the 1990s, if that sort of personal viewpoint in filmmaking has some potential as well. 

This is one of the things I say to my students. (Whenever you say the things you say to your students out loud to the world, it always sounds a bit ridiculous!) A good way to look at documentary film throughout history is one attempt and failure after another to capture reality and to tell the truth. One after another. It's not linear. The first “documentarian,” quote unquote, Robert Flaherty, of course was fictionalizing things. He was as radical a filmmaker as Oppenheimer is. 

You can look at great films throughout history and say that was an attempt to get to some deeper understanding of reality. The difference with writing—on the page, there are many traditions you're working from from the page. There's strict news journalism, all the way to fantasy writing. They're always in conversation with each other because there's relatively more stability with words than there are with images. Words can be highly problematic, of course, but images are infinitely more problematic by their nature.

I think there are two kinds of creative writers—the kind who's like, "I'm going to explore myself, my soul," and the one that's like, "I'm going to think about my audience a lot." Does that spill over into filmmaking?

There's valuable work made in both modes. I just recently saw a couple of independent filmmakers whom I really like, basically saying, "There's no meaning in my work. What does meaning even mean?"

I was like, "Wow, I feel the exact opposite of that." I feel I want to be in conversation about what meaningfulness is. Maybe that's because I think like a documentary filmmaker, which means I think I can't control things. So if I can get to meaning, it's a fucking miracle. I'm not a good writer, I'm not a good director. I'm not like, "I can write a great piece of dialogue that can explain the world to someone." No, I can fabricate a situation, and then within that, I can see something, and observe it intimately, and know how to contextualize it, and edit it so that it's deeper, so that you get some meaning out of it.

I don't think the meaning's coming from me! It's coming from the thing that happened. That's a different locus of where the meaning is happening. What I mean by “meaning” is a deep care for the audience. The viewer has to be in conversation with the images. 

Watching both “Kate Plays Christine” and “Actress" (pictured above), I was struck by how well, and how frequently, you layer some narration and voiceover over an image, and they're working together or even against each other in a really unexpected way. It feels like it draws out meaning that wasn't even in the minds of the speaker.

That's what I love about editing. In editing, you can find a voice, where in reality it's noise. We start the program at the Murray Center with editing, with me teaching editing. That is the first thing you should think about. It's not the last thing you should think about, because editing is where all the ethical questions come up.

Editing and nonfiction are completely combined. If it's not edited, it's a live feed, and that matters when you talk about nonfiction. The writing process in fiction is much more important, because with your writing you're really setting the stage for everything you're going to do down the road. In nonfiction, the editing is the writing. You have to let the footage tell you how to write for it. 

There are multiple places in "Actress" where Brandy is talking about playing a “role,” and there's so many layers to what she's saying that it feels scripted. 

Actors certainly say those things. The thing about Brandy was that all that “playing your role” stuff was suddenly radically present tense in her life. That sort of collapsed in who she is as a performer, as a person who—camera or no camera—is always performing. As I like to say, she's projecting to the rafters, whether you're intercepting that with a camera or not. It was a moment which we didn't expect going into it, had her very real situation was in conversation. I would never say something like her life has ended up the way she is because she's an actor, but we were just happen to be making a project that brought up all that stuff.

In “Actress,” it feels like you got lucky as a filmmaker with how events unfold in the film. In “Kate Plays Christine,” it feels like you're constantly unlucky throughout. I talked to someone yesterday who said, "I liked it, but then I was really frustrated that they just couldn't find anything they were looking for."

That's also by design. The premise of the film is that we're not going to be able to solve this riddle. Let's make a film about not being able to solve something. Those interviews, I was so excited when they were—well, I didn't have to edit them to be uninsightful. For example, the first thing the historian said is, "I don't know anything." I said, "Perfect." He's like, "What do you mean perfect? How can that be perfect?" If he really doesn't think there's anything here and he's the preeminent soul of the story, that's great—that says everything about why I was obsessed with the story from the start, which is that I don't know anything. I can't know anything. That is frustrating, and also says everything at the same time.

Then there's the anchor at the news station who's very serious about saying that Christine's actions were “all for nothing,” that she “accomplished nothing.” Kate's reaction is so great.

That's Kate's reaction whenever I say anything stupid, too.

You watch it and you're like, "Maybe he's right. He seems authoritative. He's the guy who's used to being on screen, too." Right?

That's a total performance in every way. He believes very much in what he's saying. It was a rough moment, because that is totally what you think: what he's basically saying, "Why are you making your stupid movie?" I could be offended by that, or I could be like, "Good point." 

We're talking about these questions of manipulation, or whatever. It really is trust. If you trust the people making the film to be honest about their manipulations, then there's some chance for productivity there. The moment you break that trust, that feeling it's over.

It's such a wishy-washy word, but I really love that documentaries are not about truth—they're about honesty. Honesty implies I'm doing the best I can to tell you what I know, not I'm telling you the God's truth about this. I feel like, for example, someone who's super Christian and explains the world via her understanding of the Bible, is being honest. Do you see what I mean?

Yes.

I'm vehemently pro-choice but, when I'm talking to an anti-choice person, I'm like, “I can understand your fire because you really believe that we're killing those babies; you really believe that we're taking that person's life.” That's what the filmmaker's job is, to speak from a position of I'm doing my best here to tell you the truth. It's limited, because it's subjective, but I'm going to try my hardest. For me, that means that in “Actress,” when she's walking over the bridge, no one's surprised to know that we shot that later. That is a staged moment.

The reason it's a staged moment is because that actually happened, exactly as we show it, but I was not going to film it the first time around because I was super creeped out. My choice was, do I not film it, and then it turns out it was important to Brandy so we decide to reconstruct it? Or, do I hide in the bushes and zoom in from the side, film super grainy, zoomed in close up of her making out with some guy? That's more truthful and it's much more of a lie, and it's much less productive, in every way.

No one watching “Actress,” 25 minutes in, is going to be like, "Wait a minute, is this real?" They're already in tune with what we're doing. That's your job as a filmmaker. I tell my students this all the time, you teach your viewers how to watch the movie.

Which happens right at the beginning of “Actress,” when Brandy interrupts and repeats herself, and it's obvious it's for the camera. That's the moment where you're like "Oh! I get this. Okay."

I know what I'm watching.

Yeah. I'm so glad that wasn't at the end of the film.

One self-critical aspect of your question about criticism and filmmaking: when you're writing criticism, when you're writing anything, you really want to sound smart about the thing that you're responding to. That's what my filmmaking is too. Maybe that's bullshit, maybe that's a dumb way to approach anything. 

But I want to be like, "We're all smart here, I'm just going try to be smart too." And that's what you're doing when you're writing criticism. You're like, "Come on, I'm smart. Look at my turn of phrase to describe this moment that is indescribable in some ways." Right? 

That's how I feel, as a filmmaker. I'm like using turns of phrase in my filmmaking, in a sense. But hopefully, it rises above that, because that would be terrible if that's where it stopped.


programming: Pretty cool javascript programming environment

submitted by /u/t-rod
[link] [comments]

programming: Css is powerful, you can do a lot of things without js

submitted by /u/pedro1122
[link] [comments]

Electronics-Lab: Everything You Need To Know About Bluetooth beacons in A White Paper

Image courtesy of Google

Bluetooth 4.0 introduced the Bluetooth low energy (BLE), which is a version of Bluetooth protocol designed for devices with power constraints like battery powered sensors. Bluetooth low energy beacons are BLE (Bluetooth Low Energy) enabled devices, they repeatedly broadcast radio signals to nearby smartphones, containing a small amount of data.
Mobile apps can listen to the signals being broadcast and trigger an action after analyzing beacon’s information.

Beacons are used for proximity-aware applications like positioning and navigation indoors like anti-lost tracking tags, another application is for location based advertisements.

There is no official Bluetooth Special Interest Group (SIG) beacon standard, so beacons have pseudo-standards. For example, iBeacon standard is used by Apple and Eddystone is used for Google.

Apple iBeacon Advertising Packet
Apple iBeacon Advertising Packet

As you can see in the above image, there is one byte (power) value indicating the iBeacon’s calibrated output power in dBm measured at a distance of 1 meter.
So Beacons can be used to calculate the proximity distance between the beacon and the receiver of beacon’s information. This calculation relies on a comparison of a Received Signal Strength Indicator (RSSI) to a beacon’s transmit (Tx) power to approximate the distance to the beacon.
The calculated distance can’t be very accurate, since RF signals fade unpredictably according to real-world environmental factors like walls. Future versions of BLE will solve this by using Angle-of-Arrival (AoA) and Angle-of-Departure (AoD) which allow a multi-antenna Bluetooth device to accurately determine the spatial location of another Bluetooth device.

Beacons typically use non-connectable advertising, providing all of useful information in the advertising packet itself. So the radio can be shut off immediately after advertising hence this will save power.

A white paper from Silicon Labs covers a lot of informations about Beacons. The paper examines beacon applications, provides a short description of how BLE work, contains further description of iBeacon and Eddystone standards and highlights SoC solutions for BLE from Silicon Labs such as BLE112 and BLE113 which can have fully standalone applications through a simple scripting language called BGScript developed by Silicon Labs.

BGScript iBeacon example code for the BGM111 Bluetooth low energy module
BGScript iBeacon example code for the BGM111 Bluetooth low energy module

References:

Developing Beacons with Bluetooth Low Energy (BLE) Technology

Beacons: Everything you need to know

Reading “Getting Started with Bluetooth Low Energy by Kevin Townsend, Carles Cufí, Akiba, and Robert Davidson (O’Reilly)” is advisable for anyone like to know more about who BLE works which is a corner stone to understand how beacons work.

The post Everything You Need To Know About Bluetooth beacons in A White Paper appeared first on Electronics-Lab.

Better Embedded System SW: Boehm's Top 10 Software Defect Reduction list

A while back, Barry Boehm & Vic Basili wrote a nice summary of best ways to get better quality software. Their advice still applies to embedded systems today. Below is their list (in bold) with my commentary (the parts not in bold).

1. Finding and fixing a software problem after delivery is often 100 times more expensive than finding and fixing it during the requirements and design phase

Bug fix cost gets worse as your software gets closer to deployment, because you have to not only spend a lot of time tracking down the source of the bug, but also retest the system after the fix.  It is common to find situations in which a bug "escape" into field units costs dramatically more than 100x.  Consider having to recall a fleet of cars to install a bug fix, or do maintenance visits to thousands of sites to manually install a fix.  (Over-the-air fixes have their own problems, but that's a topic for another time.)

2. Current software projects spend about 40 to 50 percent of their effort on avoidable rework.

As the joke goes, the first 90% of the project is spent on design, and the second 90% on debugging.  The cheapest way to debug is to avoid putting the bugs into the software in the first place.  The next best way is to find them at the point of introduction (e.g., peer review of design before code is written) rather than at system test.

3. About 80 percent of avoidable rework comes from 20 percent of the defects

If you have a "bug farm" that's often not because the code is bad, but rather because the underlying requirements and design are bad.  If one module has a lot of bugs you should rewrite the module rather than keep patching it.  However, if during the rewrite you might well discover that the problem isn't really the code, but rather a bad design or unclear requirements. Writing new code for a bad design ultimately won't solve the problem.

4. About 80 percent of the defects come from 20 percent of the modules, and about half the modules are defect free. 

In addition to comments for #3 above, modules with high cyclomatic complexity tend to be difficult to test and tend to be more bug-prone.  Keeping a limit on complexity can help with this problem.

5. About 90 percent of the downtime comes from, at most, 10 percent of the defects.

It makes sense to weight testing on the areas that are the highest risk.  For desktop software this often corresponds to the common use cases.  For embedded systems and other mission-critical systems this also means testing failure detection and recovery for high-cost failures.

6. Peer reviews catch 60 percent of the defects.

Yes, really.  Peer reviews catch the majority of defects.  Why aren't you doing them?  (If you are doing them, are they catching at least half the defects?)


7. Perspective-based reviews catch 35 percent more defects than nondirected reviews.

When you do reviews, give each reviewer a checklist with a different set of areas to think about or different role to play.  For example, control flow, data flow, exception handling, testability, coding style.

8. Disciplined personal practices can reduce defect introduction rates by up to 75 percent.

As much fun as it is to be a coding cowboy, on average even the best programmer will introduce fewer bugs by following a methodical engineering practice rather than slinging code. As mentioned above, the cheapest bugs to fix are the ones that never made it into the code.  Beyond this, there are practices such as PSP and TSP that are shown to dramatically improve quality without really changing productivity.

9. All other things being equal, it costs 50 percent more per source instruction to develop high-dependability software products than to develop low-dependability software products. However, the investment is more than worth it if the project involves significant operations and maintenance costs.

In other words, if a product recall puts your company out of business, it's worth investing in good software quality up front.  In my experience if you are already shipping a mission-critical product you're already spending that 50 percent more (and then some), but still shipping defects.  This isn't saying spend even more.  Rather, doing peer reviews and some other basic software quality practices you can improve quality at the same cost you're already spending.  Testing software into submission is simply not the way to go.

10. About 40 to 50 percent of user programs contain nontrivial defects.

If you have programmable features, your customers will have bugs in what they do.  And don't forget that your financial management spreadsheets are user programs (i.e., can, and often do have bugs).

Items #1 - #10 from:
  Boehm & Basili, Software Defect Reduction Top 10 List, IEEE Computer, Jan. 2001, pp. 135-137.

You can read the original three-page article here:
  https://www.cs.umd.edu/projects/SoftEng/ESEG/papers/82.78.pdf

Tudor Girba's blog: Lam Research evaluates Pharo

We are very happy to make the following announcement:

Lam Research, a leading supplier of wafer fabrication equipment and services to the global semiconductor industry, is an experienced user of the Smalltalk programming language. Smalltalk is a key component in Lam’s software control system for a broad range of the equipment it manufactures. Tudor Girba is a leading member of the tools and environment development effort in Pharo, having architected the Glamorous Toolkit for live programming. Eliot Miranda is author of the Cog virtual machine that underlies Pharo and other Smalltalk dialects.

Lam has engaged Tudor and Eliot to explore potential enhancements in Lam’s use of Smalltalk. These enhancements range from running highly optimized Smalltalk on low cost, single board computers, to enhancing Lam’s Smalltalk development practices with state-of-the-art live programming. During the engagement, Tudor and Eliot successfully moved a key communication component of the control system to Pharo. It was a challenging task aimed at extending the reach of Lam’s system to the Pharo world including the option of executing on ARM processors.

Cheers,
Tudor Girba, Eliot Miranda and Chris Thorgrimsson

BOOOOOOOM!: Animation of the Day: “I’m Dead Inside”

im-dead-inside2

One of my favourite animators Dan Britt returns with another brilliant short, “I’m Dead Inside”, handling the visuals and the music! He previously contributed to Don’t Hug Me I’m Scared and made the brilliant animation “I Decided to Leave”. I can’t really tell if things like this are considered dark humour or just regular humour anymore. Maybe you can let me know one way or the other.

I highly recommend you watch “I’m Dead Inside” over on Booooooom TV.

things magazine: Raise the roof higher

A tranche of new music curated at Bandcamp Daily / women in publishing, at Motherland, ‘an online destination for women who happen to be mums’ / Peter Garritano’s series Hajwalah looks at drifting culture in the Middle East. See also … Continue reading

BOOOOOOOM!: Artist Spotlight: Kajahl Benes

Kajahl-Benes15

A selection of paintings by Brooklyn-based artist Kajahl Benes. More images below.

Perlsphere: Cultured Perl

Back in about 2008, I set up a group blog called “Cultured Perl”. The idea was to have a blog that concentrated on the Perl community rather than the technical aspects that most Perl bloggers write about most of the time. It didn’t last very long though and after a few posts it quietly died. But the name “Cultured Perl” still appeals to my love of bad puns and I knew I would reuse it at some point.

At YAPC Europe 2010 in Pisa, I gave a lightning talk called Perl Vogue. It talked about the way the Perl modules come into fashion and often go out of fashion again very quickly. I suggested an online Perl magazine which would tell people which modules were fashionable each month. It was a joke, of course (not least because Vogue are famously defensive of their brand.

Over the last many years people have suggested that the Perl community needs to get “out of the echo chamber” and talk to people who aren’t part of the community. For example, instead of posting and answering Perl questions on a Perl-specific web site like Perl Monks, it’s better to do it on a general programming site like Stack Overflow.

Hold those three thoughts. “Cultured Perl”, online Perl magazine, getting out of the echo chamber.

Medium is a very popular blogging site. Many people have moved their blogging there and it’s a great community for writing, sharing and recommending long-form writing. I get a “recommended reading” email from Medium every day and it always contains links to several interesting articles.

Medium has two other features that interest me. Firstly, you can tag posts. So if you write a post about web development using Perl and tag it with “web dev” then it will be seen by anyone who is following the web dev tag. That’s breaking out of the echo chamber.

Secondly, Medium has “publications”. That is, you can bring a set of articles together under your own banner. Publication owners can style their front page in various ways to differentiate it from Medium’s default styling. Readers can subscribe to publications and they will then be notified of every article published in that publication. That’s an online magazine.

So I’ve set up a publication on Medium (called “Cultured Perl” – to complete the set of three ideas). My plan is to publish (or republish) top quality Perl articles so we slowly build a brand outside of the echo chamber where people know they can find all that is best in Perl writing.

If you write about Perl, please consider signing up to Medium, becoming a contributor to Cultured Perl and submitting your articles for publication. I’ll publish the best ones (and, hopefully, work with authors to improve the others so they are good enough to publish).

I’m happy to republish stuff from your other blogs. I’m not suggesting that we suddenly move all Perl blogging to Medium. For example, whenever I publish something on Perl Hacks, the post gets mirrored to a Perl Hacks publication that I set up on Medium earlier this year. There’s a WordPress to Medium plugin that does that automatically for me. There may well be similar tools for other blogging platforms (if you can’t find one for your blog – then Medium has an API so you could  write one).

If you are a reader, then please consider subscribing to Cultured Perl. And please recommend (by clicking on the heart symbol) any articles that you enjoy. The more recommendations that an article gets, the more likely it becomes that Medium will recommend it to other readers.

I have no idea how this will go, but over the next few months I hope to start by publishing four or five articles every week. Perhaps you could start by submitting articles about what a great time you had at YAPC Europe.

Oh, and here are the slides from the lightning talk I used to announce this project at YAPC Europe in Cluj-Napoca, Romania yesterday.

 

The post Cultured Perl appeared first on Perl Hacks.

Computer Science: Theory and Application: Automata Theory Approach to Predicate Intuitionistic Logic: "[t]he automata are constructed in such a way that any successful run corresponds directly to a normal proof in the logic." [abstract + link to PDF]

submitted by /u/flexibeast
[link] [comments]

BOOOOOOOM!: Pattern — The Simple Drawing App Every Designer Has Been Waiting For

1-pattern-screenshot

Pattern is a fantastic little iPad app (available in the App Store as of today) created by former Facebook product designer Andy Chung, specifically for the purpose of ideation and early stage design. Its simple tools and charming interface feel equal parts whiteboard and grid paper.

I love this app! You can see in the video clip below just how beautifully considered it is. Everything feels natural and intuitive, and it makes creating with the Apple Pencil and gestures fast and fun. A web layout with notes scrawled over it, literally takes seconds.

 

 

Andy has given us 5 promo codes to download Pattern for free! We’ll hook up the first 3 people who leave a comment here telling us what crazy thing you hope it will help you design.

At the end of the day we’ll also pick 2 more people from all the comments to also receive the promo codes (I may pick the funniest two answers, just saying).

Hit the button below and scroll to the bottom of this post to leave a comment! There’s a few more images of the app down there as well.

 

Penny Arcade: News Post: Gears of War 4 the watch!

Gabe: I haven’t had the watch long but it’s already time to defend my title. I plan on practicing by trying to cut Jerry in half with a real chainsaw. Perhaps the watch will change wrists this #pax. Only time, and a very bloody Gears of War 4 match between Gabe and Tycho will tell. Join us at the show or on stream #forthewatch #gears4 A photo posted by Penny Arcade (@pamegacorp) on Aug 24, 2016 at 4:33pm PDT Tycho and I have assembled teams and we will battle in just a couple weeks at PAX! Also, if you like cool pictures from the Penny Arcade office you should subscribe to the…

s mazuk: redactron: Opening of current affairs/entertainment...



redactron:

Opening of current affairs/entertainment program “Fantástico,” Brazil, 1983

Disquiet: Forum Digging and the Fate of Netlabels

rfcoct14_medium

Radio Free Culture WFMU exists to, per its credo, “examine issues at the intersection of digital media and the arts.” I was excited to be interviewed for the podcast by Erik Schoster, aka the musician He Can Jog. We talk about a wide range of subjects, including the role of netlabels in the age of streaming, listening strategies in our age of sonic abundance (forum digging as the new crate digging), the benefits and challenges of platform agnosticism (in light of the Disquiet Junto’s shifting dependence on SoundCloud), the imminent 250th weekly Disquiet Junto project, the imminent 20th anniversary of Disquiet.com (December 13, 2016), and the return to active duty of Aphex Twin.

I can’t seem to sort out how to embed the audio here, but you can listen at prx.org.

Ideas from CBC Radio (Highlights): Reimagining Ecology

Three experts in urban and environmental conservation discuss an ecological approach to the restoration and preservation of both wilderness and cityscapes.

Penny Arcade: News Post: Party In The Front

Tycho: I will buy Deus Ex and play it as soon as I get five fucking minutes to rub together.  I’ve been spinning fucking gold over here on Google Docs and when I say fucking gold I mean bronze at best or even tin but weirdly enough it all takes the same amount of time to make.  Even with that being firmly established, there are a couple things I know about the new one just because I’m a fan. There comes a time when every Acquisition must end - a Final Incorporation, if you will - and for Acquisitions Incorporated: The Series, that time is now.  Check out this…

Quiet Earth: Director Chad L. Scheifele Talks Writing, Casting and Courting Controversy in NATURAL SELECTION [Interview]

With so many films being released every week, it's hard to be noticed among the throngs, particularly so when your movie doesn't star a widely recognizable face. First time director Chad L. Scheifele has found a way to cut through the noise by tackling controversial subject matter.


An adaptation of his short film of the same name, Natural Selection stars Mason Dye as Tyler, a teen with a troubled family life who finds himself in the role of "new kid in school" when he moves into town with his mom. At first picked on, Tyler soon finds himself befriending Indrid (Ryan Munzert), a popular kid who also has a bit of a dark streak but it quickly becomes clear that Indrid's antics aren't just for show.


Natural Selection isn't particularly subtle and the performances are, a [Continued ...]

Colossal: Unwieldy LEGO Sculptures Reveal a Multitude of Hidden Shadow Designs

muntean-gif-1

GIF via Sploid

Artist John V. Muntean (previously) constructs bulky objects that spin on a single axis that when paired with a light source reveal a multitude of projected shadow images. Two of his latest creations were built with tens of thousands of LEGOs, each with three separate images contained within a single sculpture. Watch the videos below to see how the work. (via Sploid)

muntean-1

muntean-2

Disquiet: What Sound Looks Like


In contrast with many home-brew domestic doorbell fixes, this one is easily understood. The black void where there was once a button for apartment number four has been addressed, so to speak, with a newer-model plastic standalone item. The photo may not make this clear, but that isn’t duct tape around the newer button. It’s a metal sheath of the same material as the gate. Despite what the varied buttons suggest, someone is in fact concerned with design continuity at this multi-unit building. If the broken button wasn’t easily rewired, the question lingers as to whether up in apartment four this new button is mirrored by a new bell. Perhaps every time it rings, it echoes through the building as a reminder to neighbors of other petty differences.

An ongoing series cross-posted from instagram.com/dsqt.

Paper Bits: Seymour Papert dreamed of a learning revolution — why hasn’t it happened?

Seymour Papert dreamed of a learning revolution — why hasn’t it happened?

Open Culture: The Best 100 Movies of the 21st Century (So Far) Named by 177 Film Critics

Mulholland Drive Cover

When prompted to think of the cinematic peaks of the 20th century, or of specific decades like the 1930s, the 1970s, or the 1990s, we can usually thread up specific examples in the projector of our mind right away. Grand Illusion and Gone with the Wind! Taxi Driver and The GodfatherPulp Fiction and Fargo! But in this century it gets trickier. This probably doesn’t have to do with a precipitous drop in the quality of cinema itself, nor with a lack of films to consider — indeed, the 2000s and 2010s so far have burdened cinephiles with more critically-acclaimed pictures than they can get around to seeing.

The relative recency of the movies of the 21st century presents something of a challenge, since the zeitgeist hasn’t had quite enough time to digest most of them. And what now constitutes the “zeitgeist,” anyway? We live in a postmodern time, we often read, and that usually seems to mean that a greater variety of aesthetic sensibilities, historical periods, and world cultures now coexist for us on an essentially level playing field than ever before. The experience of the modern moviegoer reflects this condition, as does the BBC’s list of the 21st century’s 100 greatest films (so far), the top ten of which follow:

  1. Mulholland Drive (David Lynch, 2001)
  2. In the Mood for Love (Wong Kar-wai, 2000)
  3. There Will Be Blood (Paul Thomas Anderson, 2007)
  4. Spirited Away (Hayao Miyazaki, 2001)
  5. Boyhood (Richard Linklater, 2014)
  6. Eternal Sunshine of the Spotless Mind (Michel Gondry, 2004)
  7. The Tree of Life (Terrence Malick, 2011)
  8. Yi Yi: A One and a Two (Edward Yang, 2000)
  9. A Separation (Asghar Farhadi, 2011)
  10. No Country for Old Men (Joel and Ethan Coen, 2007)

To produce the list, the BBC surveyed 177 critics “from every continent except Antarctica. Some are newspaper or magazine reviewers, others write primarily for websites; academics and cinema curators are well-represented too.” They note that they include the year 2000, though not technically part of the century, since “not only did we all celebrate the turn of the millennium on 31 December 1999, but the year 2000 was a landmark in global cinema, and, in particular, saw the emergence of new classics from Asia like nothing we had ever seen before,” not just Yi Yi and In the Mood for Love but Ang Lee’s Crouching Tiger, Hidden Dragon a bit down the list.

France, though a country closely associated with mid-20th-century cinema, makes an admirable showing here with the likes of Agnès Varda’s The Gleaners & I, Michael Haneke’s Caché, Claire Denis’ White Material, and Jean-Luc Godard’s voyage into 3D, Goodbye to Language. Some films shamefully overlooked at their initial release, like Kenneth Lonergan’s Margaret and Andrew Dominik’s The Assassination of Jesse James by the Coward Robert Ford, appear here as perhaps a prelude to their rightful rediscovery. We can tell which auteurs have defined the cinematic century so far by the presence of more than one of their works: the late Abbas Kiarostami‘s Ten and Certified Copy both appear, as do three films by Thailand’s Apichatpong Weerasethakul and six by those still-ambitious once-wunderkinds of American cinema, the Andersons Wes and Paul Thomas.

Most of these movies exploit, to a deeper extent than the critically acclaimed pictures of decades previous, the creation of dreamlike experiences possible in film. None do it more vividly, perhaps, than the occupier of the top spot, David Lynch’s Mulholland Drive. The selection will surprise some readers, and others not at all. What makes that particular movie so good? Conveniently, the BBC provides on the sidebar a link to an article by Luke Buckmaster explaining just that.

Buckmaster compares Mulholland Drive to Citizen Kane, “writer/director Orson Welles’ esteemed 1941 feature film debut – BBC Culture’s critics poll of the 100 greatest American films last year put Kane at number one. If Kane can be viewed as an essay on the nuts and bolts of film-making – a masterclass in technical processes, from montage to deep focus, dissolves and the manipulation of mise en scèneMulholland Drive’s appeal is more thematic and conceptual. It is less a demonstration of how great cinema is achieved than what great cinema can achieve, its capacity for ideas seemingly endless.” May the remaining 84 years of the 21st century find that capacity more endless still.

See the BBC’s complete list here.

Related Content:

1,150 Free Movies Online: Great Classics, Indies, Noir, Westerns, etc.

The 10 Greatest Films of All Time According to 846 Film Critics

The 10 Greatest Films of All Time According to 358 Filmmakers

120 Artists Pick Their Top 10 Films in the Criterion Collection

Based in Seoul, Colin Marshall writes and broadcasts on cities and culture. He’s at work on a book about Los Angeles, A Los Angeles Primer, the video series The City in Cinema, the crowdfunded journalism project Where Is the City of the Future?, and the Los Angeles Review of Books’ Korea Blog. Follow him on Twitter at @colinmarshall or on Facebook.

The Best 100 Movies of the 21st Century (So Far) Named by 177 Film Critics is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

Disquiet: Listening to Yesterday: Conference Call

  1. conference call
  2. user interface

Mac_Old_Design_GoToMeeting

The conference call lasted a little over an hour, four people in four different buildings on two different coasts. The discussion was mediated by a software interface. The software allowed for screen-sharing, but especially prominent on the interface, this being a live conversation, were markers for various aspects of the audio. A little microphone symbol was situated next to each speaker’s name — that’s speaker as in human, not as in sound-emitting technology — and a horizontal meter registered how loud someone was talking. Whoever spoke, their name appeared prominently next to the word “talking.” This was an imperfect approach, since had someone been sharing my laptop with me, my name would have appeared when they spoke. On this call we all knew each other well enough that the names were unnecessary.

I’ve seen variations on this speaker-identification model over the years. One that particularly stuck in my memory used a spatial relationship for the voices, so you’d see them on the screen in a manner that suggested they were, in essence, in different seats. It was a bit like an ambisonic Jedi Council: If you listened on headphones, the voices were also situated spatially across the stereo spectrum. You had the option to move them to where you wanted them, so you could group them according to role or organization. It seemed particularly useful as a means to evenly distribute the people who talked too much.

On the conference call tool yesterday, the microphone button was red when someone had muted it, green when they had it live. Color is a whole other ball of wax from sound. There are especially strong cultural associations with color, though the associations also vary widely around the globe. In the west, red is often seen as an admonition (stop, warning), whereas in Asia it can suggest happiness (good luck, joy). On this call, red was intended as neutral, a simple “off” in an on/off binary world, but it seemed to still carry some cultural baggage. I had it on red/mute most of the time so that my typing of notes didn’t fill up the sonic conversation space. I couldn’t help but think, though, that the red next to my name was unintentionally signaling disinterest. I also wondered if any of these whiz-bang digital conference-call tools could just filter out keyboard clatter.

things magazine: Art and photographs

Harvard Art Museums makes available a large searchable Bauhaus archive / Get in the Sea / Tom Gauld’s Jetpack, a great tumblr / yet more visual insights into Historic London / another look at Henry Ford’s failed jungle utopia, Fordlandia … Continue reading

Embedded in Academia: Compilation and Hyperthreading

Hyperthreading (HT) may or may not be a performance win, depending on the workload. I had poor luck with HT in the Pentium 4 era and ever since then have just disabled it in the BIOS on the idea that the kind of software that I typically wait around for—compilers and SMT solvers—is going to get hurt if its L1 and L2 cache resources are halved. This post contains some data about that. I’ll just start off by saying that for at least one combination of CPU and workload, I was wrong.

The benchmark is compilation of LLVM, Clang, and compiler-rt r279412 using Ninja on an Intel i7-5820K, a reasonably modern but by no means new Haswell-E processor with six real cores. The compiler doing the compilation is a Clang 3.8.1 binary from the LLVM web site. The machine is running Ubuntu 14.04 in 64-bit mode.

Full details about the machine are here. As an inexpensive CPU workhorse I think it stands the test of time, though if you were building one today you would double (or more) the RAM and SSD sizes and of course choose newer versions of everything. I’m particularly proud of the crappy fanless video cards I found for these machines.

This is the build configuration command:

cmake -G Ninja -DLLVM_TARGETS_TO_BUILD=host -DLLVM_ENABLE_ASSERTIONS=1 -DCMAKE_C_COMPILER=clang -DCMAKE_CXX_COMPILER=clang++ -DCMAKE_BUILD_TYPE=Release ..

Then, on an otherwise idle machine, I built LLVM five times for each degree of parallelism up to 16, both with and without hyperthreading. Here are the results. Since the variation between runs was very low—a few seconds at worst—I’m not worrying about statistics.

What can we take away from this graph? The main conclusion is that hyperthreading wins handily, reducing the best-case build time from 11.75 minutes to 10.04 minutes: an improvement of 1 minute and 42 seconds. Also, I had been worried that simply enabling HT would be detrimental since Linux would sometimes schedule two threads on the same real core when a different core was idle. The graph shows that either this happens only rarely or else it doesn’t hurt much when it happens. Overloading the system (forking more compilers than there are processors) hurts performance by just a very small amount. Of course, at some point the extra processes would use all RAM and performance would suffer significantly. Finally, the speedup is impressively close to linear until we start running more than one thread per core:

I don’t know how much of the nonlinearity comes from resource contention and how much comes from lack of available parallelism.

Here are the first and second graphs as PDF.

Looking at the bigger picture, a huge amount of variation is possible in the compiler, the software being compiled, and the hardware platform. I’d be interested to hear about more data points if people have them.

Colossal: A Museum Dedicated to Miniature Architectural Models Opens in Tokyo

ARCHI-DEPOT_09

Earlier this summer, Archi-Depot opened within Tokyo’s Shinagawa district, a warehouse museum dedicated to the storage and display of Japanese architectural models. Created by the company Warehouse TERRADA (previously), the cavernous space houses rows and rows of dramatically-lit miniature designs, many of which serve as the tiny precursors to some of the city’s top attractions such as the Tokyo Skytree, Tokyo International Airport, and the Asakusa Culture and Tourism Center.

Each of the models stacked within the museum’s 17-foot-tall interior contain a QR code, a feature that provides quick access to further information about the architectural works. Digital details include blueprints, photographs of the finalized building or structure, and examples of other projects the head architect has completed during their career. One architect in particular, Kengo Kuma, has been selected to design the 2020 World Olympics stadium. Although this project is still within its planning stages, a few of his completed projects’ models are stored within the museum. These works include the China Academy of Arts’ Folk Art Museum and the Asakusa cultural center mentioned above. Other architects included in the museum’s collection are Jun Aoki, Shigeru Ban, Wonderwall, Torafu, and many more as the collection is continuously expanding.

In addition to this growing permanent display, Archi-Depot also hosts rotating exhibitions of newer models or more conceptual pieces in its exhibition area. Currently the museum has an exhibition of works by Japanese architecture firm Wonderwall that will be on display through the end of the year. Last month we had a chance to visit the museum, and were blown away by the immense detail put into each of the tiny pieces, especially considering they are often stored away from the public eye. You can have a chance to browse the collection by either visiting the museum Tuesday through Sunday from 11 AM to 9 PM, or visit digitally on their website and Instagram.

ARCHI-DEPOT_03   ARCHI-DEPOT_05

ARCHI-DEPOT_01

ARCHI-DEPOT_04  ARCHI-DEPOT_02

ARCHI-DEPOT_12

ARCHI-DEPOT_06

ARCHI-DEPOT_07

ARCHI-DEPOT_08

Paper Bits: “Get back to work.” Samhain supervises from her...



“Get back to work.”

Samhain supervises from her box.

Saturday Morning Breakfast Cereal: Saturday Morning Breakfast Cereal - Rocks



Hovertext:
What I do is a draw pictures and people look at the pictures and they like the pictures and so I draw more pictures.

New comic!
Today's News:

TOPLAP: ‘A Second Home’ composition featuring tidal

Maher_Dennis_516Sampsonia-5063lr

Dennis Maher‘s three-story installation at the Mattress Factory entitled ‘A Second Home’ features a musical piece composed by Dubravka Bencic and Kevin Bednar which includes various uses of tidalcycles.

Maher_Dennis_516Sampsonia-4881lr                                                              Maher_Dennis_516Sampsonia-5048lr

“A Second Home” transforms the Mattress Factory row house at 516 Sampsonia Way into a mysterious wonderland that cleaves, intermingles, and collages a house’s physical and metaphysical counterparts. Saturated with construction materials, furnishings, toys, architectural models, video projections, and audio elements, the resulting immersive environment—encompassing all three floors of the building—fosters the emergence of a radically interior world: one that dreams of memories that it has never had, conjures the places that it has always wanted to be, and draws its own magic out of the grains of the woodwork.

In creating the accompaniment to this installation, all sounds were sourced from within the home itself.  Miscellaneous metallic, wooden, plastic, and various other textured samples were later arranged and re-used with tidal – along with live-coded manipulation of Dubravka’s piano performance which flows throughout the duration of the work.

Maher_Dennis_516Sampsonia-4939lr

Similar sounds and approaches are to be featured on a forthcoming album which is slated to be released later this year!

More information on the installation can be found here and here.

Penny Arcade: Comic: Party In The Front

New Comic: Party In The Front

explodingdog: (again, this time with the correct words.)



(again, this time with the correct words.)

Electronics-Lab: How to compare your circuit requirements to active-filter approximations

SLYT681_Fig2

By Bonnie C. Baker (WEBENCH® Senior Applications Engineer):

Numerous filter approximations, such as Butterworth, Bessel, and Chebyshev, are available in popular filter software applications; however, it can be time consuming to select the right option for your system. So how do you focus in on what type of filter you need in your circuit? This article defines the differences between Bessel, Butterworth, Chebyshev, Linear Phase, and traditional Gaussian low-pass filters. A typical Butterworth low-pass filter is shown in Figure 1.

How to compare your circuit requirements to active-filter approximations – [Link]

The post How to compare your circuit requirements to active-filter approximations appeared first on Electronics-Lab.

Electronics-Lab: RFM69 WIFI Gateway

20160819_002338x

The RFM69GW is a RFM69 to MQTT gateway that uses the ubiquitous ESP8266 chip. There are two or three similar projects that I’m aware of but I’ve put together some hardware and firmware features that make it different. by Xose Pérez:

  • I’m using Felix Rusu’s RFM69_ATC library so it supports Monteino nodes with Auto Transmission Control feature enabled for an adaptative transmission power: longer battery life & less radio pollution
  • RFM69CW footprint, compatible with RFM12B and hence with old Monteinos or even with JeeNodes (untested)
  • Web configurable map between node messages and MQTT topics.
  • EEPROM persistent configuration using the awesome Embedis library by PatternAgents

RFM69 WIFI Gateway – [Link]

The post RFM69 WIFI Gateway appeared first on Electronics-Lab.

Electronics-Lab: Program an Arduino with State Machines in 5 Minutes

Statechart-Platine-Arduino

by Lothar Wendehals:

Did you ever program an Arduino? Have you ever been worried about complex control flows written in pure C? Maybe you have already heard of statecharts and state machines? In this blog post, I will show you how to program an Arduino in just 5 minutes in a model-driven way with the help of  YAKINDU Statechart Tools (SCT).

Program an Arduino with State Machines in 5 Minutes [Link]

The post Program an Arduino with State Machines in 5 Minutes appeared first on Electronics-Lab.

Electronics-Lab: Teensy 3.5 and 3.6 Are Here !

“Teensy” is a tiny size board compatible with Arduino software and libraries. Teensy 3.1 & 3.2 was the last version from Paul Stoffregen (PJRC Company) the creator of Teensy.

Prev_Teensy

Table is from PJRC website
Table is from PJRC website

Paul started a Kickstarter campaign for The new Teensy 3.5 and 3.6 and until the time of preparation of this post, there are 1,697 backers and campaign raised $102,974 of the $5,000 goal with 15 days to go.

Teensy 3.6
Teensy 3.6
Teensy 3.5
Teensy 3.5

Teensy 3.5 and Teensy 3.6 have slightly differences. I made a full comparison in the bellow table:

Teensy3536

Teensy 3.5 has a lower in features MCU (RAM, Flash, clock and some peripherals) which make it slightly cheaper than Teensy 3.6. Teensy 3.5 has 5v tolerance on all digital I/O pins.
Only Teensy 3.6 has a USB High Speed (480 Mbit/sec) port accessed using 5 pins on the board.

Teensy36USB

 

Teensy 3.5 and Teensy 3.6 are 6-layer PCB with 28 pins compatible with previous Teensy3.x models.

Teensy_comp

As we said, Teensy is compatible with Arduino software so Arduino IDE is the primary method used to program Teensy 3.6 and Teensy 3.5.

Paul (PJRC company) offered Teensy 3.5  for 23$ and Teensy 3.6 for 28$ for the Kickstarter campaign backers shipped in October.

Via:HackerBoards

 

The post Teensy 3.5 and 3.6 Are Here ! appeared first on Electronics-Lab.

s mazuk: Video



Explosm.net: Comic for 2016.08.24

New Cyanide and Happiness Comic

Disquiet: Music for Piano and Cicada

The piano is not entirely lost, though per the title of the track it is deconstructed, and muddied by the presence of a field recording. The full track title is “Deconstructed piano improvisation and Field recording etude No.5,” by Robert Rizzi of Kolding, Denmark. The field recording is largely bug noise, “this summer of cicadas on Mallorca, Spain,” according to Rizzi. Amid the high-pitching buzzing, the piano is heard cutting in and out, notes more like shards than notes. They break in the middle or start midway. They repeat like a stutter, like a memory caught on a loop, sometimes so swiftly that the digital processing is self-evident, but often with a whispery, casual quality — almost flute-like at times — that makes this half-real piano sound just as real, just as natural, as nature’s own looping white noise.

Track originally posted at soundcloud.com/rizzi. More from Rizzi at twitter.com/RobertColeRizzi.

Planet Haskell: Michael Snoyman: Restarting this blog

Just a minor note: I'm planning on starting up this blog again, with some personal thoughts - likely still mostly around programming and Haskell - that don't fit in the other blogs that I contribute to (Yesod Web Framework and FP Complete).

I don't have a clear list of topics I'm going to be covering, but I'll likely be sharing some thoughts on running engineering teams and startups effectively. If you have something you'd like me to cover, please Tweet it to me.

explodingdog: Photo



Paper Bits: 10 things you need to learn in design school if you‘re tired of wasting your money — Dear Design Student

10 things you need to learn in design school if you‘re tired of wasting your money — Dear Design Student

BOOOOOOOM!: Illustrator Spotlight: Rune Fisker

runefisker17

A selection of work by Danish illustrator Rune Fisker. More images below.

Paper Bits: ‘Burn every single ni**er!’: This is how Trump supporters talk when they think nobody’s listening

‘Burn every single ni**er!’: This is how Trump supporters talk when they think nobody’s listening

Planet Haskell: Roman Cheplyaka: Extract the first n sequences from a FASTA file

A FASTA file consists of a series of biological sequences (DNA, RNA, or protein). It looks like this:

>gi|173695|gb|M59083.1|AETRR16S Acetomaculum ruminis 16S ribosomal RNA
NNTAAACAAGAGAGTTCGATCCTGGCTCAGGATNAACGCTGGCGGCATGCCTAACACATGCAAGTCGAAC
GGAGTGCTTGTAGAAGCTTTTTCGGAAGTGGAAATAAGTTACTTAGTGGCGGACGGGTGAGTAACGCGTG

>gi|310975154|ref|NR_037018.1| Acidaminococcus fermentans strain VR4 16S ribosomal RNA gene, partial sequence
GGCTCAGGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAGAACTTTCTTCGGAATGTTC
TTAGTGGCGAACGGGTGAGTAACGCGTAGGCAACCTNCCCCTCTGTTGGGGACAACATTCCGAAAGGGAT

There probably exist dozens of python scripts to extract the first \(n\) sequences from a FASTA file. Here I will show an awk one-liner that performs this task, and explain how it works.

Here it is (assuming the number of sequences is stored in the environment variable NSEQS):

awk "/^>/ {n++} n>$NSEQS {exit} {print}"

This one-liner can read from standard input (e.g. as part of a pipe), or you can append one or more file names to the end of the command, e.g.

awk "/^>/ {n++} n>$NSEQS {exit} {print}" file.fasta

An awk script consists of one or more statements of the form pattern { actions }. The input is read line-by-line, and if the current line matches the pattern, the corresponding actions are executed.

Our script consists of 3 statements:

  1. /^>/ {n++} increments the counter each time a new sequence is started. /.../ denotes a regular expression pattern, and ^> is a regular expression that matches the > sign at the beginning of a line.

    An uninitialized variable in awk has the value 0, which is exactly what we want here. If we needed some other initial value (say, 1), we could have added a BEGIN pattern like this: BEGIN {n=1}.
  2. n>$NSEQS {exit} aborts processing once the counter reaches the desired number of sequences.
  3. {print} is an action without a pattern (and thus matching every line), which prints every line of the input until the script is aborted by exit.

A shorter and more cryptic way to write the same is

awk "/^>/ {n++} n>$NSEQS {exit} 1"

Here I replaced the action-without-pattern by a pattern-without-action. The pattern 1 (meaning “true”) matches every line, and when the action is omitted, it is assumed to be {print}.

Paper Bits: Apple’s Product Development Process – Inside the World’s Greatest Design Organization

Apple’s Product Development Process – Inside the World’s Greatest Design Organization

Jesse Moynihan: Forming 233

OUR VALUED CUSTOMERS: While discussing HARLEY QUINN and Halloween...


Perlsphere: solving the 24 game in Forth

About a month ago, Mark Jason Dominus posted a simple but difficult arithmetic puzzle, in which the solver had to use the basic four arithmetic operations to get from the numbers (6, 6, 5, 2) to 17. This reminded me of the 24 Game, which I played when I paid my infrequent visits to middle school math club. I knew I could solve this with a very simple Perl program that would do something like this:

    for my $inputs ( permutations_of( 6, 6, 5, 2 ) ) {
    for my $ops ( pick3s_of( qw( + - / * ) ) ) {
      for my $grouping ( 'linear', 'two-and-two' ) {
        next unless $target == solve($inputs, $ops, $grouping);
        say "solved it: ", explain($inputs, $opts, $grouping);
      }
    }
  }

All those functions are easy to imagine, especially if we're willing to use string eval, which I would have been. I didn't write the program because it seemed obvious.

On the other hand, I had Forth on my brain at the time, so I decided I'd try to solve the problem in Forth. I told Dominus, saying, "As long as it's all integer division! Forth '83 doesn't have floats, after all." First he laughed at me for using a language with only integer math. Then he told me I'd need to deal with fractions. I thought about how I'd tackle this, but I had a realization: I use GNU Forth. GNU's version of almost everything is weighed down with oodles of excess features. Surely there would be floats!

In fact, there are floats in GNU Forth. They're fun and weird, like most things in Forth, and they live on their own stack. If you want to add the integer 1 to the float 2.5, you don't just cast 1 to int, you move it from the data stack to the float stack:

  2.5e0 1. d>f f+

This puts 2.5 on the float stack and 1 on the data stack. The dot in 1. doesn't indicate that the number is a float, but that it's a double. Not a double-precision float, but a two-cell value. In the Forth implementation I'm using, 1 gets you an 8-byte 1 and 1. gets you a 16-byte 1. They're both integer values. (If you wrote 1.0 instead, as I was often temped to do, you'd be making a double that stored 10, because the position of the dot doesn't matter.) d>f takes a double from the top of the data stack, converts it to a float, and puts it on the top of the float stack. f+ pops the top two floats, float-adds them, and pushes the result back onto the float stack. Then we could verify that it worked by using f.s to print the entire float stack to the console.

Important: You have to keep in mind that there are two stacks, here, because it's very easy to manipulate the wrong stack and end up with really bizarre results. GNU Forth has locally named variables, but I chose to avoid them to keep the program feeling more like Forth to me.

initialization

I'm going to run through how my Forth 24 solver works, not in the order its written, but top-down, from most to least abstract. The last few lines of the program, something like int main are:

    17e set-target
  6e 6e 5e 2e set-inputs

  ." Inputs are: " .inputs
  ." Target is : " target f@ fe. cr
  ' check-solved each-expression

This sets up the target number and the inputs. Both of these are stored, not in the stack, but in memory. It would be possible to keep every piece of the program's data on the stack, I guess, but it would be a nightmare to manage. Having words that use more than two or three pieces of data from the stack gets confusing very quickly. (In fact, for me, having even one or two pieces can test my concentration!)

set-target and set-inputs are words meant to abstract a bit of the mechanics of initializing these memory locations. The code to name these locations, and to work with them, looks like this:

    create inputs 4 floats allot              \ the starting set of numbers
  create target 24 ,                        \ the target number

  : set-target target f! ;

  \ sugar for input number access
  : input-addr floats inputs + ;
  : input@ input-addr f@ ;
  : input! input-addr f! ;
  : set-inputs 4 0 do i input-addr f! loop ;

create names the current memory location. allot moves the next allocation forward by the size it's given on the stack, so create inputs 4 floats allot names the current allocation space to inputs and then saves the next four floats worth of space for use. The comma is a word that compiles a value into the current allocation slot, so create target 24 , allocates one cell of storage and puts a single-width integer 24 in it.

The words @ and ! read from and write to a memory address, respectively. set-target is trivial, just writing the number on the stack to a known memory location. Note, though, that it uses f!, a variant of ! that pops the value to set from the float stack.

set-inputs is built in terms of inputs-addr, which returns the memory address for given offset from inputs. If you want the final (3rd) input, it's stored at inputs plus the size of three floats. That's:

    inputs 3 floats +

When we make the three a parameter, we swap the order of the operands to plus so we can write:

    floats inputs + ( the definition of input-addr )

set-inputs loops from zero to three, each time popping a value off of the float stack and storing it in the next slot in our four-float array at input.

operators

Now we have an array in memory storing our four inputs. We also want one for storing our operators. In fact, we want two: one for the code implements an operator and one for a name for the operator. (In fact, we could store only the name, and then interpret the name to get the code, but I decided I'd rather have two arrays.)

    create op-xts ' f+ , ' f- , ' f* , ' f/ ,
  create op-chr '+  c, '-  c, '*  c, '/  c,

These are pretty similar to the previous declarations: they use create to name a memory address and commas to compile values into those addresses. (Just like f, compiled a float, c, compiles a single char.) Now, we're also using ticks. We're using tick in two ways. In ' f+, the tick means "get the address of the next word and compile that instead of executing the word." It's a way of saying "give me a function pointer to the next word I name." In '+, the tick means "give me the ASCII value of the next character in the input stream."

Now we've got two arrays with parallel indexes, one storing function pointers (called execution tokens, or xts, in Forth parlance) and one storing single-character names. We also want some code to get items out of theses arrays, but there's a twist. When we iterate through all the possible permutations of the inputs, we can just shuffle the elements in our array and use it directly. When we work with the operators, we need to allow for repeated operators, so we can't just shuffle the source list. Instead, we'll make a three-element array to store the indexes of the operators being considered at any given moment:

    create curr-ops 0 , 0 , 0 ,

We'll make a word curr-op!, like ones we've seen before, for setting the op in position i.

    : curr-op! cells curr-ops + ! ;

If we want the 0th current operator to be the 3rd one from the operators array, we'd write:

    3 0 curr-op!

Then when we want to execute the operator currently assigned to position i, we'd use op-do. To get the name (a single character) of the operator at position i, we'd use op-c@:

    : op-do    cells curr-ops + @ cells op-xts + @ execute ;
  : op-c@    cells curr-ops + @ op-chr + c@ ;

These first get the value j stored in the ith position of curr-ops, then get the jth value from either op-xts or op-chr.

permutations of inputs

To get every permutation of the input array, I implemented Heap's algorithm, which has the benefit of being not just efficient, but also dead simple to implement. At first, I began implementing a recursive form, but ended up writing it iteratively because I kept hitting difficulties in stack management. In my experience, when you manage your own stacks, recursion gets significantly harder.

    : each-permutation ( xt -- )
    init-state

    dup execute

    0 >r
    begin
      4 i <= if rdrop drop exit then

      i i hstate@ > if
        i do-ith-swap
        dup execute
        i hstate1+!
        zero-i
      else
        0 hstate i cells + !
        inc-i
      then
    again
    drop
    ;

This word is meant to be called with an xt on the stack, which is the code that will be executed with each distinct permutation of the inputs. That's what the comment (in parentheses, like this) tells us. The left side of the double dash describes the elements consumed from the stack, and the right side is elements left on this stack.

init-state sets the procedure's state to zero. The state is an array of counters with as many elements as the array being permuted. Our implementation of each-permutations isn't generic. It only works with a four-element array, because init-state works off of hstate, a global four element array. It would be possible to make the permutor work on different sizes of input, but it still wouldn't be reentrant, because every call to each-permutation shares a single state array. You can't just get a new array inside each call, because there's no heap allocator to keep track of temporary use of memory.

(That last bit is stretching the truth. GNU Forth does have words for heap allocation, which just delegate to C's alloc and friends. I think using them would've been against the spirit of the thing.)

The main body of each-permutation is a loop, built using the most generic form of Forth loop, begin and again. begin tucks away its position in the program, and again jumps back to it. This isn't the only kind of loop in Forth. For example, init-state initializes our four-element state array like this:

    : init-state 4 0 do 0 i hstate! loop ;

The do loop there iterates from 0 to 3. Inside the loop body (between do and loop) the word i will put the current iteration value onto the top of the stack. It's not a variable, it's a word, and it gets the value by looking in another stack: the return stack. Forth words are like subroutines. Every time you call one, you are planning to return to your call site. When you call a word, your program's current execution point (the program counter), plus one, is pushed onto the return stack. Later, when your word hits an exit, it pops off that address and jumps to it.

The ; in a Forth word definition compiles to exit, in fact.

You can do really cool things with this. They're dangerous too, but who wants to live forever? For example, you can drop the top item from the return stack before returning, and do a non-local return to your caller's caller. Or you can replace your caller with some other location, and return to that word -- but it will return to your caller's caller when it finishes. Nice!

Because it's a convenient place to put stuff, Forth ends up using the return stack to store iteration variables. They have nothing to do with returning, but that's okay. In a tiny language machine like those that Forth targets, some features have to pull double duty!

begin isn't an iterating loop, so there's no special value on top of the return stack. That's why I put one there before the loop starts with 0 >r, which puts a 0 on the data stack, then pops the top of the data stack to the top of the return stack. I'm using this kind of loop because I want to be able to reset the iterator to zero. I could have done that with a normal iterating loop, I guess, but it didn't occur to me at the time, and now that I have working code, why change it?

Iterator reset works by setting i back to 0 with the zero-i word. In a non-resetting loop iteration, we increment i with inc-i. Of course, i isn't a variable, it's a thing on the return stack. I made these words up, and they're implemented like this:

    : zero-i r> rdrop 0 >r >r ;
  : inc-i  r> r> 1+ >r >r ;

Notice that both of them start with r> and end with >r. That's me saving and restoring the top item of the return stack. You see, once I call zero-i, the top element of the return stack is the call site! (Well, the call site plus one.) I can't just replace it, so I save it to the data stack, mess around with the second item on the return stack (which is now the top item) and then restore the actual caller so that when I hit the exit generated by the semicolon, I go back to the right place. Got it? Good!

Apart from that stuff, this word is really just the iterative Heap's algorithm from Wikipedia!

nested iteration

Now, the program didn't start by using each-iteration, but each-expression. Remember?

    ' check-solved each-expression

That doesn't just iterate over operand iterations, but also over operations and groupings. It looks like this:

    : each-expression ( xt -- )
    2 0 do
      i 0= linear !
      dup each-opset
      loop drop ;

It expects an execution token on the stack, and then calls each-opset twice with that token, setting linear to zero for the first call and 1 for the second. linear controls which grouping we'll use, meaning which of the two ways we'll evaluate the expression we're building:

    Linear    : o1 ~ ( o2 ~ ( o3 ~ o4 ) )
  Non-linear: (o1 ~ o2) ~ (o3 ~ o4)

each-opset is another iterator. It, too, expects an execution token and repeatedly passes it to something else. This time, it calls each-permutation, above, once with each possible combination of operator indexes in curr-op.

    : each-opset ( xt -- )
    4 0 do i 0 curr-op!
      4 0 do i 1 curr-op!
        4 0 do i 2 curr-op!
          dup each-permutation
          loop loop loop drop ;

This couldn't be much simpler! It's exactly like this:

    for i in (0 .. 3) {
    op[0] = i
    for j in (0 .. 3) {
      op[1] = j
      for k in (0 .. 3) {
        op[3] = k
        each-permutation
      }
    }
  }

inspecting state as we run

Now we have the full stack needed to call a given word for every possible expression. We have three slots each for one of four operators. We have four operands to rearrange. We have two possible groupings. We should end up with 4! x 4³ x 2 expression. That's 3072. It should be easy to count them by passing a counting function to the iteator!

  create counter 0 ,
: count-iteration
  1 counter +!    \ add one to the counter
  counter @ . cr  \ then print it and a newline
  ;

' count-iteration each-expression

When run, we get a nice count up from 1 to 3072. It works! Similarly, I wanted to eyeball whether I got the right equations, so I wrote a number of different state-printing words, but I'll only show two here. First was .inputs, which prints the state of the input array. (It's conventional in Forth to start a string printing word's name with a dot, and to end a number printing word's name with a dot.)

    : .input  input@ fe. ;
  : .inputs 4 0 do i .input loop cr ;

.inputs loops over the indexes to the array and for each one calls i .input, which gets and prints the value. fe. prints a formatted float. Here's where I hit one of the biggest problems I'd have! This word prints the floats in their order in memory, which we might think of as left to right. If the array has [8, 6, 2, 1], we print that.

On the other hand, when we actually evaluate the expression, which we'll do a bit further on, we get the values like this:

  4 0 do i input@ loop \ get all four inputs onto the float stack

Now the stack contains [1, 2, 8, 6]. The order in which we'll evaluate them is the reverse of the order we had stored them in memory. This is a big deal! It would've been possible to ensure that we operated on them the same way, for example by iterating from 3 to 0 instead of 0 to 3, but I decided to just leave it and force myself to think harder. I'm not sure if this was a good idea or just self-torture, but it's what I did.

The other printing word I wanted to show is .equation, which prints out the equation currently being considered.

    : .equation
    linear @
    if
      0 .input 0 .op
      ((
        1 .input 1 .op
        (( 2 .input 2 .op 3 .input ))
      ))
    else
      (( 0 .input 0 .op 1 .input ))
      1 .op
      (( 2 .input 2 .op 3 .input ))
    then
    ." = " target f@ fe. cr ;

Here, we pick one of two formatters, based on whether or not we're doing linear evaluation. Then we print out the ops and inputs in the right order, adding parentheses as needed. We're printing the parens with (( and )), which are words I wrote. The alternative would have been to write things like:

    ." ( " 2 .input 2 .op 3 .input ." ) "

...or maybe...

    .oparen 2 .input 2 .op 3 .input

My program is tiny, so having very specialized words makes sense. Forth programmers talk about how you don't program in Forth. Instead, you program Forth itself to build the language you want, then do that. This is my pathetic dime store version of doing that. The paren-printing functions look like:

    : (( ." ( " ;
  : )) ." ) " ;

testing the equation

Now all we need to do is write something to actually test whether the equations hold and tell us when we get a winner. That looks like this:

    : check-solved
    this-solution target f@ 0.001e f~rel
    if .equation then ;

This is what we passed to each-expression at the beginning! We must be close to done now...

this-solution puts the value of the current expression onto the top of the (float) stack. target f@ gets the target number. Then we use f~rel. GNU Forth doesn't give you a f= operator to test float equality, because testing float equality without thinking about it is a bad idea, because it's too easy to lose precision to floating point mechanics. Instead, there are a bunch of float comparison operators. f~rel takes three items from the stack and puts a boolean onto the data stack. Those items are two values to compare, and an allowed margin of error. We're going to call the problem solved if we're within 0.001 of the target. If we are, we'll call equation. and print out the solution we found.

The evaluator, this-solution, looks like this:

    : this-solution
    4 0 do i input@ loop

    linear @ if
      2 op-do 1 op-do 0 op-do
    else
      2 op-do
      frot frot
      0 op-do
      fswap
      1 op-do
    then
    ;

What could be simpler, right? We get the inputs out of memory (meaning they're now in reverse order on the stack) and pick an evaluation strategy based on the linear flag. If we're evaluating linearly, we execute each operator's execution token in order. If we're grouping, it works like this:

            ( r1 r2 r3 r4 ) \ first, all four inputs are on the stack
  2 op-do ( r1 r2 r5    ) \ we do first op, putting its result on stack
  frot    ( r2 r5 r1    ) \ we rotate the third float to the top
  frot    ( r5 r2 r1    ) \ we rotate the third float to the top again
                          \ ...so now the "bottom" group of inputs is on top
  0 op-do ( r5 r6       ) \ we do the last op, evaluating the bottom group
  fswap   ( r6 r5       ) \ we restore the "real" order of the two groups
  1 op-do ( r7          ) \ we do the middle op, and have our solution

That's it! That's the whole 24 solver, minus a few tiny bits of trivia. I've published the full source of the program on GitHub.

Saturday Morning Breakfast Cereal: Saturday Morning Breakfast Cereal - Consequentialism



Hovertext:
This is why I randomly generate an ethical system every morning.

New comic!
Today's News:

CreativeApplications.Net: Out of Line – Crowdsourced interactive music video by Moniker and Studio Puckey

outofline_04Directed and developed by Moniker and Studio Puckey, Out of Line involves hundreds of animated lines being drawn by visitors on top of the music video. All drawn lines are saved on their servers and are then rendered into the video to be seen by future visitors.

BOOOOOOOM!: Illustrator Spotlight: Jee-ook Choi

jee-ook18

A selection of work by South Korean illustrator Jee-ook Choi. More images below.

OCaml Weekly News: OCaml Weekly News, 23 Aug 2016

  1. OCaml-MariaDB
  2. CPS converting existential data type
  3. OASIS v0.4.7
  4. Other OCaml News

OCaml Planet: Caml Weekly News: OCaml Weekly News, 23 Aug 2016

  1. OCaml-MariaDB
  2. CPS converting existential data type
  3. OASIS v0.4.7
  4. Other OCaml News

things magazine: Borrowed and Billowing

X-ray images by Xavier Lucchesi / still life photography by Andrew B.Myers / Paging Adam Curtis – ‘Nooscope mystery: The strange device of Putin’s new man Anton Vaino’ / the rise of ‘Borrowing Clubs‘ / parenting styles distilled, a review … Continue reading

churchturing.org / 2016-08-26T03:09:16