Bifurcated Rivets: From FB

No. Just no.

Bifurcated Rivets: From FB

This is insanely good

Bifurcated Rivets: From FB


Bifurcated Rivets: From FB

Geordie haka

Bifurcated Rivets: From FB


Slashdot: Firefox Support For NPAPI Plugins Ends Next Year

An anonymous reader writes: Mozilla announced that it will follow the lead of Google Chrome and Microsoft Edge in phasing out support for NPAPI plugins. They expect to have it done by the end of next year. "Plugins are a source of performance problems, crashes, and security incidents for Web users. ... Moreover, since new Firefox platforms do not have to support an existing ecosystem of users and plugins, new platforms such as 64-bit Firefox for Windows will launch without plugin support." Of course, there's an exception: "Because Adobe Flash is still a common part of the Web experience for most users, we will continue to support Flash within Firefox as an exception to the general plugin policy. Mozilla and Adobe will continue to collaborate to bring improvements to the Flash experience on Firefox, including on stability and performance, features and security architecture." There's no exception for Java, though.

Read more of this story at Slashdot.

Hackaday: Open Source FPGA Pi Hat

Over on, [Dave Vandenbout] has posted the CAT board, a Raspberry Pi daughterboard hat that features a Lattice FPGA, 32 MB of RAM, EEPROM, and a few Grove and PMOD connectors. The CAT takes advantage of the open source tool chain available for Lattice including the Python-based MyHDL (although, you could just use Verilog directly, if you prefer) and Icestorm. One interesting point: you can run the tool chain on the Raspberry Pi, resulting in a self-contained and largely portable FPGA development environment.

The design files are actually on Github. You may notice the SATA connectors. However, [Dave] doesn’t know if you could really use SATA drives with them–they are there for general purpose differential I/O.

It is great to have an open source board and tool chain for FPGA development. We’ve talked about the open source Icestorm toolchain before and MyHDL, too.  If you prefer, most of the vendor FPGA tools are free to use for many common devices and uses. The Lattice tools should work just as well with this board, even if it does offend your open source sensibilities.

The video below introduces the CAT board, but be warned: it does contain actual cat pictures. It does not, however, contain any apologies to Dr. Seuss.

Filed under: FPGA, Raspberry Pi experimental-0.016

Experimental features made easy PPIx-Refactor-0.03

Hooks for refactoring perl via L Twilio-1.000

Standards compliant interface to the Twilio API Tie-Hash-DBD-0.16

Tie plain hashes to DBI interface

Recent additions: wx

Added by HenkJanVanTuyl, Sat Oct 10 10:42:14 UTC 2015.

wxHaskell Spreadsheet-Read-0.63

Meta-Wrapper for reading spreadsheet data

Recent additions: wxc

Added by HenkJanVanTuyl, Sat Oct 10 10:05:35 UTC 2015.

wxHaskell C++ wrapper

Slashdot: Open-Source Doom 3 Advances With EAX Audio, 64-bit ARM/x86 Support

An anonymous reader writes: Dhewm3, one of the leading implementations of the Doom 3 engine built off the open-source id Tech 4 engine, has released a new version of the GPL-licensed engine that takes Doom 3 far beyond where it was left off by id Software. The newest code has full SDL support, OpenAL + OpenAL EFX for audio, 64-bit x86/ARM support, better support for widescreen resolutions, and CMake build system support on Linux/Windows/OSX/FreeBSD. This new open-source code can be downloaded from Dhewm3 on GitHub but continues to depend upon the retail Doom 3 game assets.

Read more of this story at Slashdot.

Recent additions: scientific

Added by BasVanDijk, Sat Oct 10 08:43:33 UTC 2015.

Numbers represented using scientific notation

Hackaday: Original Hackers’ New Satellite in Orbit

Ham radio put another satellite in orbit, the FOX-1A. Not many groups have the long-term hacking credentials of hams. Their tradition extends back to the first days of radio communications, which puts the group well over a century old. This newest satellite launched in the early hours of October 8th and, after deployment, was heard later the same day. Anyone with the ability to listen on the 2m band can hear FOX-1A. Tatlas-v-rocket-launches-nrol55-cubesatshose licensed as hams will be able to communicate using a 70cm transmitter while listening on 2m.

This satellite is using the cube-sat format and ‘ride sharing’ through a program offered by NASA and the National Reconnaissance Office (NRO). Twelve other nano-satellites rode along with the FOX-1A. These 10 cm cubes are used for commercial, educational, and non-profit projects. The purpose of today’s satellites covered not only ham radio but educating students in satellite construction, land management by American Indian tribes, and space to ground laser communication. Yeah, what’s cooler than space lasers? Video about the FOX-1A after the break.

We’ve seen some interesting ideas for cube-sats. And if you want to think about the ground portion of a system like this, check out the SatNOGs story — winners of the 2014 Hackaday Prize.

Filed under: radio hacks

Recent additions: hsignal

Added by VivianMcPhail, Sat Oct 10 07:30:26 UTC 2015.

Signal processing and EEG data analysis

programming: Vorpal: the first framework for interactive CLIs in Node.

submitted by dt3ree
[link] [1 comment]

programming: Why SQL is neither legacy, nor low-level, nor difficult, nor the wrong place for (business) data logic, but is simply awesome!

submitted by lukaseder
[link] [84 comments]

Recent additions: qux

Added by hjwylde, Sat Oct 10 06:48:26 UTC 2015.

Command line binary for working with the Qux language

Slashdot: BBC Optimizing UHD Video Streaming Over IP

johnslater writes: A friend at the BBC has written a short description of his project to deliver UHD video over IP networks. The application bypasses the OS network stack, and constructs network packets directly in a buffer shared with the network hardware, achieving a ten-fold throughput improvement. He writes: "Using this technique, we can send or receive uncompressed UHD 2160p50 video (more than 8 Gbps) using a single CPU core, leaving all the rest of the server's cores free for video processing." This is part of a broader BBC project to develop an end-to-end IP-based studio system.

Read more of this story at Slashdot.

programming: Creating a BitTorrent client in Haskell - part 1

submitted by N3mes1s
[link] [comment]

MetaFilter: What's the frequency, kid?

A Highly Irregular Children's Story: David Gates reviews The Slightly Irregular Fire Engine, a children's book by Donald Barthelme. [Virginia Quarterly Review, Spring 1976]

MetaFilter: The Rhythm of Life

Because, at 1:32 am, you need to feel a bit of the Rhythm of Life.

Hackaday: 64bits Of Development Board

Whether we need them or not, we don’t usually shy away from a development board. [Keith] sent us a tip on the DragonBoard 410c after reading our recent coverage of the latest Beagleboard release. Arrow Electronics is manufacturing (and distributing, not surprisingly) the first Qualcomm Snapdragon 400 series based development board. At the time of writing there are two boot images on the site available for download Android 5.1 and an Ubuntu based version of Linux.

The DragonBoard 410c is stuffed with an Arm Cortex-A53 (Arm block diagram after the break) with max speed of 1.2GHz and support for 32bit and 64bit code. It also has on-board GPS, 2.4GHz WiFi, Bluetooth 4.1, full size HDMI connector, a micro USB port that operates in only device mode, two full size USB 2.0 ports for host mode, a micro SD card slot. In the way of GPIO it has a 40 pin low speed connector and a 60 pin high speed connector, there is also an additional 16 pin breakout for analog audio, and the list goes on (follow links above for more info).

For those of you playing buzzword drinking games not to worry, the board can be made Arduino compatible by using the mezzanine connector and there is a plan for the board to be Windows 10 compatible. Better make that a double!

Cortex_A53_diagram GALLERY_CROP_DragonBoard-UpdatedImages-side DragonBoard-UpdatedImages-front
Filed under: ARM Comic for 2015.10.10

New Cyanide and Happiness Comic

MetaFilter: #15Girls: 15yr old girls seeking to take control and change their fate

Refuse to share a pencil, reject a boy, say no to your imprisoned dad — all of these can get a teen girl killed in El Salvador's gang war - "Aby, whose best friend disappeared, is still staying at home. Her latest aspiration is to be the director of NASA." Warning: Some of the depictions and images in this story are graphic.
If you were standing at the U.S.-Mexico border two summers ago during the so-called "surge" of unaccompanied minors trying to come to the U.S., you would have seen thousands of young girls from El Salvador.

If you had asked them why they came, they would have told you the answer is simple: gangs. Back in the 1980s, during El Salvador's civil war, many people migrated from El Salvador to the U.S. On the streets of cities like Los Angeles, they formed gangs.

Then, many of them were deported back to El Salvador. And they brought the gangs with them. Now, El Salvador's two main gangs — Mara Salvatrucha (MS-13) and Barrio 18 — control much of the country. There is so much violence in El Salvador that someone dies there, on average, every hour.

Much of the killing is over turf or revenge. And sometimes people are just caught in the middle. Many times, those caught in the middle are girls.

We went to El Salvador to talk to these girls, to understand why they would want to make the perilous journey to the U.S., why they would ever want to leave home. This is the story of four of those girls.

Slashdot: Over 10,000 Problems Fixed In Detroit Thanks To Cellphone App

An anonymous reader writes: Six months ago, Detroit's city officials launched a smartphone app called "Improve Detroit." The idea was to give residents a way to easily inform city hall of problems that needed to be fixed. For example: potholes, abandoned vehicles, broken hydrants and traffic lights, water leaks, and more. Since that time, over 10,000 issues have been fixed thanks to reports from that app. "Residents have long complained about city hall ignoring litter and broken utilities. But the app has provided a more transparent and direct approach to fixing problems." Perhaps most significant is its effect on the water supply: running water has been shut off to almost a thousand abandoned structures, and over 500 water main breaks have been located with the app's help. Crowd-sourced city improvement — imagine if apps like this become ubiquitous.

Read more of this story at Slashdot.

Disquiet: A Map Is a Composition / A Composition Is a Map

Screen Shot 2015-10-09 at 8.19.40 PM

Kate Carr, who travels widely and records as she goes, is employing sound as a mapping tool. Or perhaps a better way to put it is that she is employing a map as a compositional tool.

This half-hour track is an experiment of hers. As I understand it, each three minutes marks one of 10 sites along a path of a mountain in Spain. The sound isn’t pure field recording — or it doesn’t appear to be. There seem to be edits and treatments, but perhaps the sound in the Spanish countryside is simply that surreal. There is muted singing, too — perhaps Carr in duet with the world.

She writes of the piece, which is titled “From a wind turbine to vultures (a sonic transect of a small mountain in Velez Rubio, Spain),”

This is an idea I have been working on for a while. It involves the sonic investigation of 10 sites along a sonic transect. These sites were evenly spaced along a straight line up a small mountain in a remote area in Spain. The wind turbine in the title was in the valley of the mountain, the vulture at the peak. This is just a testing out of this idea.

Screen Shot 2015-10-09 at 8.13.50 PM

She also mentions that the individual sites are noted in the track’s comments — signposts along the audio timeline — but they don’t appear to have gone live yet. The audio was uploaded earlier today.

Screen Shot 2015-10-09 at 8.13.27 PM

Track originally posted at More from Carr at,, and

Disquiet: Modular Synth Status

Screen Shot 2015-10-09 at 7.54.11 PM

Status report on my slowly evolving modular synthesizer. I’ve added the red thing in the lower left, which is a VCA mixer (details at the manufacturer, There’s an alternate version of the same item with a black faceplate, which I would have preferred, but black was an additional fee, and I’ve been trying to do this all with second-hand modules. In overly simplified terms this VCA (that’s “voltage controlled amplifier”) mixer means that I can vary the relative volume of five different channels, like have five different tweaks of the same sine wave, and move between various combinations and permutations. I think next up — to fill those dark voids — are a colored-noise source (white, brown, pink) and another VCO. After that, I’m not sure. Input is always appreciated, if you’re reading this and happen to be knowledgeable about such things. The above image is not a photo but a simulacrum from the database at

Computer Science: Theory and Application: Is hardware emulation already a field in computer science? Or anything closely related?

I discovered my niche in CS is emulation/simulation. That is something I would like to devote my life work to. Does such a field exist?

submitted by SchoolVsWork
[link] [6 comments]


WeWork Used These Documents To Convince Investors It's Worth Billions

Lambda the Ultimate - Programming Languages Weblog: GADTs Meet Their Match: Pattern-Matching Warnings That Account for GADTs, Guards, and Laziness

GADTs Meet Their Match: Pattern-Matching Warnings That Account for GADTs, Guards, and Laziness by Georgios Karachalias, Tom Schrijvers, Dimitrios Vytiniotis, Simon Peyton Jones:

For ML and Haskell, accurate warnings when a function definition has redundant or missing patterns are mission critical. But today’s compilers generate bogus warnings when the programmer uses guards (even simple ones), GADTs, pattern guards, or view patterns. We give the first algorithm that handles all these cases in a single, uniform framework, together with an implementation in GHC, and evidence of its utility in practice.

Another great paper on a very useful incremental improvement on GADTs as found in Haskell, OCaml and Idris. Exhaustiveness checking is critical for a type system's effectiveness, and the redundant matching warnings are a nice bonus.

Slashdot: Scientists Control a Fly's Heartbeat With a Laser

the_newsbeagle writes: Researchers have demonstrated a laser-based pacemaker in fruit flies, and say that a human version is "not impossible." The invention makes use of optogenetics, a technique in which the DNA that codes for a light-sensitive protein is inserted into certain cells, enabling those cells to be activated by pulses of light. Researchers often use this method to study neurons in the brain, but in this case the researchers altered flies' heart cells. Then they activated those cardiac cells using pulses of light, causing them to contract in time with the pulses (abstract). Voila, they had an optical pacemaker that worked on living adult fruit flies. Don't worry, no one can control your heartbeat with a laser just yet. That would require inserting foreign DNA into your heart cells, and also finding a way to shine light through the impediment of your flesh and bones. But lead researcher Chao Zhou of Lehigh University is working on it.

Read more of this story at Slashdot.

Hackaday: BOO! Teach Arduino Basics With this Fun Ghost

Halloween is just around the corner, and the spooky themed tips are just starting to roll in. If you’re looking to one-up the basic store-bought decorations, and maybe teach your kid the basics of an Arduino while you’re at it — why not build a Peek-A-Boo Ghost!

Using an Arduino, two servo motors and an ultrasonic distance sensor it’s pretty easy to make this cute little ghost that covers its eyes when no one is around. They’re using cardboard for the ghost, but if you have access to a laser cutter at your hackerspace, you could make it a lot more robust using MDF or plywood.

When the ultrasonic distance sensor senses someone coming towards it, it’ll trigger the arms to move — though it’d be easy to add a small speaker element too and get some spooky music going as well!

For even more spooky hacks, check out our coverage of last year’s Halloween Night at Pololu! Including impatient severed fingers, a robotic exorcism baby, and not to mention some stabby silhouettes for your windows!

Filed under: Arduino Hacks, Holiday Hacks

MetaFilter: Mother Jones wins suit against wealthy political donor

For three years, Mother Jones has been litigating a defamation suit over a piece that drew attention to the political activites of wealthy billionaire Frank VanderSloot. "This was not a dispute over a few words. It was a push, by a superrich businessman and donor, to wipe out news coverage that he disapproved of. Had he been successful, it would have been a chilling indicator that the 0.01 percent can control not only the financing of political campaigns, but also media coverage of those campaigns."

You can read the full text of the decision here.

Instructables: exploring - featured: Halloween Countdown Pumpkin

Halloween is just around the corner, so here is a fun craft to count down the days with! If you'd like to see this project in video form, please click the video above.Supplies you'll need:a fake pumpkinchalkboard paintacrylic paintlarge & small paintbrusheschalkpencil Paint the chalkboard paint on...
By: sarahndipity

Continue Reading »

Paper Bits: Photo

Hackaday: Hacklet 79 – USB Projects

Universal Serial Bus was created to simplify interconnecting computers and peripherals. First released in 1996, hackers and makers were slow to accept this strange new protocol. Parallel and serial ports were simpler, worked great, and had decades of hacking with thousands of projects behind them. As the new standard caught on in the mainstream, RS-232 and parallel ports started disappearing. “Legacy free” PC’s became the norm. Hackers, Makers, and Engineers had no choice but to jump on the bandwagon, which they did with great gusto. Today everything has a USB port. From 8 bit microcontrollers to cell phones to children’s toys. This week’s Hacklet is about some of the best USB projects on!

two partsWe start with [Michael Mogenson] and Two Component USB Temperature Data Logger, which may be the simplest USB device ever made. [Michael] isn’t kidding. This data logger consists of just a Microchip PIC16F1455 microcontroller and a USB connector. Microchip’s datasheet calls for a capacitor to smooth out power, but [Michael] made it work without the extra part. He used M-Stack by Signal 11 to implement the USB stack. Once connected to a PC, the PIC enumerates as a serial port device. It then sends its die temperature of the PIC once per second. It could do more, but that would probably require adding a few more components!

tester1Next up is [davedarko] with USB cable tester. Dave recently spent some time installing USB RFID readers. These devices were only a few meters away from the computer controlling them. Even so, the power and USB data cables had to run through pipes and in some cases under water. It wasn’t fun troubleshooting a device to find that it was a shorted USB cable causing the problem. [Dave’s] solution is a tiny coin cell powered board that tests each of the 4 wires in a standard USB 2.0 cable. The board runs on an ATtiny45 microcontroller. [Dave’s] current iteration has footprints for mini and micro USB connectors, along with the standard USB-A.


tester2[MobileWill] has a USB Tester of his own. This USB tester checks current consumption and rail voltage. It does this by connecting in-line with the device under test. It’s perfect for troubleshooting why your PC’s USB port goes into over-current protection every time you plug in your device. The tester is modular – you can use the base board with your own multimeter, or grab [Will’s] tester backpack and see the results right on the built-in OLED display. USB Tester is [Will’s] entry in the 2015 Hackaday Prize.


tbdFinally, we have [ajlitt] with Tiny Bit Dingus (TBD). TBD is a USB interface to 6 wires. Think of it as a tiny version of the bus pirate. This lilliputian board holds a Freescale KL27Z ARM processor, which has more than enough power to handle things like I2C, SPI, PWM, or just about any other way to send data or wiggle wires. [Ajlitt] started this project as an excuse to learn KiCAD and gain some experience with surface mount solder stencils. The result is an absolutely tiny board that is all but lost in a USB socket. Programming is handled with the mbed library, though you can always use Freescale’s native tools. Flashing code on the TBD is easy with kut, a chrome browser plugin.

If you want to see more USB projects, check out our new USB projects list. Did I miss your project? Don’t be shy, just drop me a message on That’s it for this week’s Hacklet, As always, see you next week. Same hack time, same hack channel, bringing you the best of!

Filed under: Hackaday Columns

Instructables: exploring - featured: sweet potato curry

This sweet potato curry is one of my favorites - I make it all the time! Sweet potatoes and chickpeas make it nice and filling when served over rice. :)And best of all, you can have this curry on the table in under 45 minutes, so it's a great weeknight dinner! I tend to make this whenever we're down...
By: jessyratfink

Continue Reading »

TwitchFilm: Trailer For #HORROR Is A Bloody MEAN GIRLS For Tweens

While trying to conjure up if there has been a tween slasher, nothing comes to mind automatically. Of course, there are loads of teen slashers throughout the past few decades, because Hollywood likes nothing more than a nubile body count. Except maybe pairing silver foxes like George Clooney with women half his age. Anyway, as tweens grow more sophisticated as the years go by in terms of dress, makeup, social status, and technology, here's a film to cater to them --- #Horror will be out on VOD as well as theatrically on November 20th from IFC Midnight. It will be the feature debut of clothing designer, actress, and producer Tara Subkoff. A group of privileged girls has a party and cyberbullying ensues. That's when things get...

[Read the whole post on]

TwitchFilm: HAIL, CAESAR! Trailer: The Coens Are Back With Movie Studio Shenanigans

"We have your movie star. Gather $100,000 and await instructions. Who are we? The Future."While the Coen Brothers actually have a film dropping in the cinema this month, as they have writing credit on Steven Spielberg's Bridge of Spies, it is safe to say that there will be no dancing sailors, or George Clooney looking pompous and dopey.  The trailer looks like a return to the meat and potatoes Coen Joint, where there is an ensemble cast, a kidnapping, and a metric tonne of shenanigans. We're firmly in Raising Arizona or The Big Lebowski territory here. But with the added period elements of a 1950s movie studio, which offers two films within the film, the eponymous "Hail, Caesar!" (look for Clancy Brown as Clooney's co-star)...

[Read the whole post on]

BOOOOOOOM!: Upside Down Sea Urchin Planters by Cathy Van Hoang


Cathy Van Hoang (a.k.a. Petit Beast) is a Los Angeles-based designer and art director. Using sea urchin shells as planters, Hoang photographs the plants upside down to create what look like floating jellyfish (with the plant becoming the tentacles). See more images of Hoang’s air plants below!

All Content: Chaz Ebert to Appear on Oprah's "Where Are They Now?" on Oct. 10


Chaz Ebert, president of The Ebert Company and publisher of, will be featured on the next episode of Oprah Winfrey's program, "Where Are They Now?", scheduled to be broadcast at 9pm CST Saturday, October 10th, on OWN. Other guests on the program include Christian pop star Amy Grant, former Chicago Bears coach Mike Ditka, army veteran-turned-"Dancing With the Stars" contestant J.R. Martinez and Oprah's longtime hairstylist Andre Walker.

Here is a sneak peek of Chaz's appearance on the program airing Saturday, in which she discusses The Roger Ebert Center at the University of Illinois in Urbana-Champaign, a project she and her late husband, film critic Roger Ebert, have long had in the works.

Chaz was previously featured on the program in 2013, following Roger's passing. The episode included footage of Roger's appearances on "The Oprah Winfrey Show," where he recalled a date he once had with the future TV icon. In 2005, Roger shared the advice he gave her in a blog post entitled, "How I Gave Oprah Her Start."

For more information on "Where Are They Now?", visit the official OWN site.

Instructables: exploring - featured: DIY Electric Longboard

Hey yall! CoolRextreme here with yet another DIY Longboard post...Yes, I will give you a detailed account of my build. From frustration to fascination. Why?Cause we all know builds are not just about going smoothly and coming together perfectly.No, I will not talk to you as if you have already done ...
By: CoolRextreme

Continue Reading »

TwitchFilm: BONE TOMAHAWK: What Is Everyone Staring At In These Character Posters?

S. Craig Zahler's western Bone Tomahawk hits cinemas, VOD and iTunes on October 23rd. We have been sent a handful of character posters from the flick. I just want to know what everyone is looking at. I find myself more interested in what is on the ground the more I look at them. What's in the dirt, Sheriff Russell? When a group of cannibal savages kidnaps settlers from the small town of Bright Hope, an unlikely team of gunslingers, led by Sheriff Franklin Hunt (Kurt Russell), sets out to bring them home. But their enemy is more ruthless than anyone could have imagined, putting their mission - and survival itself - in serious jeopardy. Kurt Russell (The Hateful Eight, Tombstone) leads an all-star cast, including Patrick...

[Read the whole post on]

Instructables: exploring - featured: My 99 Cent Shelf

It may seem hard to believe, but all I spent on this incredible shelf was a whopping ninety nine cents. Find the Wood Ok, I will grant I was incredibly lucky too. The tree was not as here in Chicago we are having issues with Emerald Ash Borer bugs killing all of our beautiful ash trees. The cit...
By: Humboldtartdept

Continue Reading »

Quiet Earth: The Bennet Sisters Kick Ass in PRIDE AND PREJUDICE AND ZOMBIES [Trailer]

Pride and Prejudice and Zombies has had a long a troubled journey to the screen, but it looks like Seth Grahame-Smith's 2009 hit novel is finally getting the adaptation we all wanted (?). In my mind, the novel sets an interesting precedent in terms of how books are created and published. It's success was warranted as an oddity, but it remains to be seen if the movie can sustain our interest for its runtime.

I think the marketing is smart to appeal directly to a female demographic here and I think fans of Auten's book will get some real joy seeing her strong character kicking ass in a less conventional way.

Jane Austen's classic tale of the tangled relationships between lovers from different social classes in 19th century England is faced with a new challenge [Continued ...]

programming: Julia 0.4 released

submitted by brombaer3000
[link] [25 comments]

Penny Arcade: News Post: It only took 13 years!

Gabe: Back in 2002 I wrote a news post about the multiplayer in the new Jedi Knight II game. I was apparently not impressed with the multiplayer and I suggested an alternative: “Just take a second and imagine the wealth of possibilities. One of the multiplayer levels could drop you into the battle of Hoth. You would have rebels on one side imperials on the other. If you joined the rebellion you would play as a rebel trooper.  Your objectives would be to defend echo base and protect the escaping transports.  If you joined the empire you would play as a snow trooper in the Imperial…

TwitchFilm: Hamburg 2015 Review: SAMURAY-S, A Stunning Meta-Hypnosis From Another Planet

Raúl Perrone's Samuray-S is a film from a different planet. It is a distant planet they once called cinema. The Argentinean maverick, who directed 28 films in 40 years without any external funding, seems to work with a whole different catalogue of technical means, has created a stunning meta-hypnosis on the genre of the samurai-film. But it is also a living proof that the feelings of fragility and disappearance are not tied to the material of film, as Samuray-S employs a fascinating approach that combines a silent film language with digital cinema. It is not an easy one to find words for. In its core, it is an epic experimental (what a silly word!) film about the sadness of enchantment or about the impossibility of...

[Read the whole post on]

Colossal: Wire Animal Sculptures that Look Like Scribbled Pencil Drawings by David Oliveira


Artist David Oliveira (previously) works with wire in an unconventional way by cutting and twisting the material into sculptures that could be mistaken for 2D sketches. Despite the apparent difficulty of shaping wire into a recognizable form, Oliveira manages to achieve uncanny proportions of his animal subjects in this series of sculptures from 2014. Viewed from one angle the pieces could be mistaken for a chaotic jumble, but a shift in perspective reveals the squinting eyes of lions, or the spread wings of a pelican. The Lisbon-based artist also creates vast interior installations of birds and thoughtful examinations of the human form. You can scroll through an archive of his work over on Facebook. (via Cross Connect)







All Content: We Lost It At Our Video Stores: The Writers Remember Movie Rental Havens


To celebrate the release of Tom Roston’s new book "I Lost It At the Video Store" (here's Glenn Kenny's review) we asked our writers to share their own memories about the VHS/DVD palaces that inflamed their cinephilia. What memories from these mostly bygone institutions did they hold closest to them? For your perusal, we've got a thriller starring Odie Henderson and a weaponized copy of "Beyond the Valley of the Dolls," a heartfelt comedy featuring Omer Mozaffar and "Cool As Ice," and of course, plenty of romance, between budding cinephiles and the rental havens that forever changed their lives.

ERIK CHILDRESS: I can remember all of the major video stores I regularly frequented the way some can recall their time and place during historical events. After the first VCR in my house it began with Leisure Tronics in Arlington Heights, IL, where the clerks called this eight-year-old "Master Childress" and blindsided me one night after mistakenly giving away the movie I reserved and replacing it with “A Nightmare On Elm Street.” "He'll like it," they told my dad. After it closed down there was Elk Grove Video, and even 7-11 got my business. After I settled on Video Plus Emporium in Elk Grove Village, I ended up getting my first job before I turned 16. It was there that I got my first taste of advance copies before they streeted. So exciting! Later I went on to Ken's World of Video, QED Laser and Hollywood Video before eventually settling into becoming a full-time film critic.

The memories of those days can fill a book and there is a part of that experience missing today. Seemingly gone are the times of anticipation for that Tuesday release or the thrill of walking in to pick out something you have never seen before. My dad would point out movies that he remembered seeing or really wanted to see. The clerks would not bat an eye when I wanted to rent “Tron” … again! My horizons expanded with every opportunity, from whatever classics were available to the cheesiest of horror films. If it was not on cable I would find it at the video store. Now everything is at our fingertips and that's a good thing in itself. Those second homes must be why I caught the collector's bug leading my love of film to transform my home into a living, breathing video store.

SEONGYONG CHO: During the early 1990s, most video rental stores in South Korea were small local independent businesses, and you always had at least one nearby rental store privately run by one of your neighbors. In the case of my neighborhood during 1993-2006, there were at least 10 video rental stores within the two-kilometer radius of an apartment complex my family lived in. In 1995, a video rental store chain named Cinema Town appeared. These rental stores usually had many classic movies besides popular ones, and I soon found myself exposed to many notable works from the likes of Alfred Hitchcock, Orson Welles, etc. And there was also one very big video rental video store in the downtown area of my hometown, and I still vividly remember those wonderful moments I spent on its lovely second floor which was full of hidden treasures including the almost complete set of David Lynch’s TV series “Twin Peaks” (somehow, its monumental pilot episode was not included in the set, so it took years until I finally saw the pilot episode on DVD). I remember well when I rented “Jaws” (1975) and “2001: A Space Odyssey” (1968) from this store in 1996—that was one double feature to remember.

OLIVIA COLLETTE: There are actually three video stores that had an enormous impact on my movie-watching habits. The first is the Blockbuster on Mountain Road in Moncton, New Brunswick, circa 1992-97. Say what you will about that franchise, but at the time, it was the only place that rented out artsy, indie, or foreign pictures, like "Exotica," "Tous les matins du monde," and "Ridicule."

The next is the Club International Video (now Le Cinoche) in Montreal, on the corner of Duluth and St-Hubert. They had such an impressive array of foreign films. I would regularly rent movies without having heard anything about them, and be consistently surprised and delighted. There was obviously some curation to the process, and the clerks clearly knew their stuff. I owe discovering "J'ai faim," "After Life," and "Nobody Knows" to the Club International.

And finally, there's Évolution 1. This place was about a block away from where I lived, and carried a healthy selection of sci-fi—ranging from popular to cultish and obscure—and managed to get many of the weird entries that made the Fantasia Festival's program each year, so that was always worth exploring. I was a regular here, and over time, the guys developed a sense of my tastes. "Absolutely Fabulous" DVDs meant I'd just had a shopping spree and was gearing up for a solo girl’s night. "Battlestar Galactica" meant we were in for a chat to dissect the latest developments in the series. Though I'm likely most proud to have introduced the young men to "Koyaanisqatsi."

NOAH GITTELL: There have been several important video stores in my life, and each played a different role. The town I grew up in had no actual downtown, just a mini-mall surrounded by residential areas. Thankfully, the mini-mall had a video store. I don't remember what I rented there, but I do remember the day I realized I could take their old posters and hang them up in my room. Coolest thing ever! When I lived in Boston a few years later, I discovered that I lived near a video store that got a jump on the competition by putting out the new releases two days early. Also the coolest thing ever! Finally, when I began studying at NYU, I discovered Kim's Video and Music. Many epitaphs and appreciations have already been written for the legendary store, so I'll just say that it's where my education in film really began. It's just a few blocks from campus, and when a couple of thoughtful professors started changing the way I thought about film, Kim's was there to supplement my formal education. Plus, I once saw Harmony Korine and Chloe Sevigny holding hands in there. Needless to say: coolest thing ever.

ODIE HENDERSON: I used to work in a small neighborhood video store, which is a bad idea if you're a film critic. I was always making recommendations ("Put that back! It's terrible!" for example), and the bosses weren't too keen on me costing them money. One movie I suggested the customer return to the shelves was "Beyond the Valley of the Dolls," but not for any quality reason. The owner of the store kept putting that movie in the porn section. The guy who stood before me had horndog porn spirals in his eyes, and he was holding the box for Russ and Roger's classic. "Is the woman on the box in the movie?" he asked me, practically panting. With most porn VHS tapes, the answer is no. But this wasn't porn, and the actress on the box was indeed in the movie. "She is," I told him, "but dude, you might want to rent something else. This isn't what you need right now." I winked at him, but he didn't get it. I tried talking him out of the movie, even suggesting a litany of other titles, but he was adamant about "Beyond the Valley of the Dolls." 

Years later, I said to Roger Ebert, "Roger, you almost got me killed." The customer returned a few hours later, madder than hell because BVD was, by triple-X standards, quite tame. After screaming at me, the guy threw the video tape at my head. He missed me, but he hit a huge store mirror behind me. Glass showered down on me and I barely escaped being shredded. A few months later, our video store (which was illegally copying and renting videos) got raided by the feds. I wonder if BVD guy tipped them off.

OMER M. MOZAFFAR: The feeling of walking into a video store was better than walking into a bookstore or library. It was like walking into a room full of portals to worlds far bigger than anything this earth could contain. It was impossible to spend less than an hour ambling through the same sections again looking carefully at each box again. The polish of Blockbuster and Hollywood Video. The barebones dingy grey design of the monster selection at Movie Mania. The foreign film section at Regal Video. And, the B-movies at that shop next to the 7-11. I worked at Suncoast Motion Picture Co. and kept trying to play one of the “Star Wars” films on the televisions. Nothing, however, came close to the first experiences, driving so many miles, to Double Exposure, to rent the brand new tape, "Michael Jackson's Thriller." Double Exposure had two aisles, and maybe 30 selections. 

My most embarrassing experience came when studying the cinematography of Janusz Kaminski, requiring me to rent "Cool as Ice," starring then-vanishing rap artist Vanilla Ice (who today seems to be making millions renovating houses). Considering the other movies I rented, that film was tame. Sharing this moment with the world is therapeutic. Especially now, looking at all those locations, replaced with sandwich shops, insurance offices, and weight loss centers that I should also visit.

MICHAŁ OLESZCZYK: My first childhood video store appeared out of nowhere when I turned eight or nine. Communism just fell across Eastern Europe and it wasn't before the dust settled after toppling of the Berlin Wall that my small town in southern Poland saw the rise of VHS. Soon, there were several video stores, of which one called "Video Fan" was my favorite. The choice of movies was laughably small by today's standards, and since the place was tiny, there was no room for the American-style display of browsable boxes. Instead, the walls of the place were lined from top to bottom with cut-outs of the covers, many crudely translated into Polish, some not translated at all. Piracy reigned supreme, quality was low, but the mythical West came to our door and we lived in a state of heightened expectation. Since VHS tapes were in demand, you had to sign up for many hit titles and wait for weeks to rent them. My faves included "Home Alone,” “Honey, I Shrunk the Kids,” and that perennial classic I still consider superior to its predecessor, "Ghostbusters II.” There were hardly any art-house releases at that time, so I spent my VHS childhood on a steady diet of high-octane Hollywood candy—which is what I now try to feed my nephews, in hope they will one day become as movie-crazy as their uncle.

BARBARA SCHARRES: The video store that had the greatest impact on me was a tiny Chinese video store in Chicago's second Chinatown at Broadway and Argyle. I no longer remember the store's name, but it was something bland and generic. By the late-80s I had fallen in love with Hong Kong cinema, and my goal was to see every Hong Kong film I could get my hands on, past or current. To the puzzlement of wary clerks, I became one of their few (maybe only, I don't know) non-Asian member/customers. I visited weekly over a period of many years, checking out large numbers of tapes. The tape quality was often terrible, but even so, I made (illegal) copies for my personal collection so I could watch my favorites over and over. I started creating my own catalog of their holdings, and spent some time each week taking notes, locating the English title (usually somewhere in fine print on the box) and noting the call number, filling in director and star names later from research. 

The store was small and very grungy. Absolutely no frills: store windows covered by torn and faded posters, battered, ripped linoleum on the floor, walls obscured by the banks of shelves of tapes. The brand new releases were often held behind the counter, so you had to ask about new titles. In time, the two young women who worked there became friendly and called me by name, although a man who sometimes worked there was prone to making snarky comments about me in Cantonese to other customers. I didn't care, because this little store was my gateway to a movie culture that was my passion. So many of the films I saw back then have dropped out of sight, and I regret that they may never be remembered by anyone. The greatest Hong Kong films and the hits by major directors can be found online now, but scores of the films that satisfied Hong Kong's once insatiable hunger for an indigenous popular cinema are nowhere to be found, and many of those were pretty darn good.

COLLIN SOUTER: In the mid-'80s, my friend Jim Peebles and I raided the dumpsters of video stores that mistakenly threw away their posters and displays. I still have a vast chunk of that poster collection at home. They weren't thinking ahead, but we were (although the posters are hardly in mint condition). I would later add to that collection throughout the '90s when I held a total of four separate video store jobs, my favorite being Entertainment Tonight Video in Mt. Prospect, IL, which had the largest collection of LaserDiscs for rent in the area. Hardcore cinephiles who demanded proper aspect ratios came from all over. That place was an early adopter of new technology, so as a customer (before becoming an employee), I was already aware of the benefits of letterboxing a film long before it became the norm. I learned from all those video store jobs that video store owners are among the most obsessive-compulsive eccentrics you would ever have the (dis)pleasure of encountering. 

My favorite video store growing up, however, was Quick Flix Video in Arlington Heights, IL. I was one of their regulars. It's where I started diving into the art house films of that era ('86 - '90) as well as discovering Woody Allen, Stanley Kubrick and “Fawlty Towers.” They had a couple rows of theater seats in the center of the store where customers could watch whatever film was playing on the jumbo screen TV. Their check-out counter was like a movie theater concession stand, with large-size candy under the glass and fresh popcorn for sale. I still miss that place.

I sometimes wonder how my two high schools jobs impacted what I do now. Were they reflections of what I was interested in at the time or predictors of what I would be doing today? Or both? It can't be mere coincidence that I worked at a book store and then managed a video store across the street. Writing/reading/film. My time at Metro News (a massive newstand that also had a hearty book selection in Birmingham, MI) and then Videomax, first across the street and then at a different store, feels like it had to be formative on my current profession, right? And yet we can't draw straight lines from one chapter of our lives to the next that easily. I will say this—it gets me thinking about the lack of both book and video stores for today's teenagers. I spent so much time wandering the aisles of both, even before I worked there, discovering authors, filmmakers, and even Roger Ebert (we had his books and even got the Sun-Times at Metro). The internet might allow for the same access but there's something tactile about picking up a VHS box or a newspaper. It's something only happening to you in that moment. And that individuality of discovery feels like it's been lost. I miss it.

SUSAN WLOSZCZYNA: One day in the early ‘80s, when my husband and I lived in Alexandria, Va., he announced that he wanted to buy an upgraded TV and our first VCR. I was beyond thrilled since I often worked nights on the copy desk and could fill up my days with movie binges. Plus the TV we did have was always threatening to fall off its wobbly stand and wound one of us. But I was less than pleased when Chris brought home “The Dresser” from Erol’s, a local electronics chain that also rented videos, as our inaugural viewing choice.

He was puzzled by my reaction since it was a highly-regard Oscar-nominated film that we had failed to see in theaters. I explained to him that was like bringing healthy granola cookies to someone who wanted decadently gooey brownies. We could watch such serious relatively recent mainstream movies anytime. I coveted tapes of a slightly lower-brow variety that were much harder to locate. On the top of my wish list: “Eraserhead” and “The Hunger.” Like the saint he is, Chris duly trudged back to return “The Dresser” and I spent the day savoring the bizarre world of David Lynch and Catherine Deneuve’s seductive bloodsucker before reluctantly going to work.

I was bit by the video bug. Hard. Anyone could rent a new release. I wanted to revel in all the films that I read about in Danny Peary’s cult movie books but could never see, whether Jean Cocteau’s “Beauty and the Beast,” “I Walked With a Zombie,” “Aguirre: Wrath of God” or “The Trip.” But Erol’s didn’t have that much in the way of off-beat offerings.

Then I learned that, less than a mile away from where we lived in Old Town, a tape rental  emporium in an old townhome was opening that catered to cinephiles who shared my appetite for less-edifying fare: The Video Vault. Its slogan was “Guaranteed Worst Movies in Town” and there were plenty of ripe-for-the-riffing turkeys that would end up being roasted on “Mystery Science Theater 3000” in the future. But there was also a rich array of classics from the Golden Age of Hollywood as well as hard-to-find foreign titles and even bootlegs, including the unreleased Rolling Stones documentary, “Cocksucker Blues.” No wonder Joey Ramone was one of the store’s best out-of-town mail-order rental customers. 

Alas, we would buy our first house a year later more than 30 miles away from The Video Vault. Occasionally we would make the trip to check out what was new. But little by little, it became less convenient to return our rentals there. Eventually, we had to make do with Blockbuster after it bought out Erol’s. It was so depressing. Their stores were as sterile and utilitarian as a hospital lobbies and the clerks usually didn’t know any movies older than yesterday.

I hadn’t thought about The Video Vault in years but I took to the Internet to see what became of the shop. Incredibly, it moved to several other locales but actually was able to hold on until 2010, even as Redbox machines and Netflix were taking hold. Yes, I find older films on streaming services or used copies of more obscure titles on the Internet now. But I miss that rush of walking into a room with shelf after shelf groaning with thousands of VHS tapes and being able to snag such rare finds like “Peeping Tom” and “Deep End.” The thrill of the hunt is gone. And I still haven’t seen “The Dresser.” 

Penny Arcade: News Post: Le Livre Des Visages

Tycho: The rumor was that Dislike was en route to Facebook, but I don’t think that was ever an authentic option and would corrode the service.  It was eventually determined that Liking Things wasn’t sufficiently granular, and so there are a raft of New Likings being rolled out.  Except they’re missing a few key inflections that apply to ninety-nine point four percent of posts. I have conversations with people all the time about whether or not they’re going to quit Facebook or they’re going to quit Facebook for real now, and I can’t think of a single time…

Jesse Moynihan: Forming 201

Blue and black borders.

TwitchFilm: See 34 Short Horror Films From Women Directors At The Ax Wound Film Festival

If you find yourself in Battleboro, Vermont tomorrow and you're itching for a smack of horror short films directed by women then the first annual Ax Wound Film Festival is where you should be. The festival will take place at the Hooker-Dunham Theater & Gallery from 2pm to 11pm and wristbands for the entire event are a paltry $5!You can read the full press release below. Note that TwitchFilm writer Izzy Lee will be attending the festival with two of her short films, Postpartum and A Favor.The Ax Wound Film Festival will showcase 34 Short Horror Films Directed by Women in Brattleboro, VT on Saturday October 10, 2015The first annual Ax Wound Film Festival (AWFF) will take place at the Hooker-Dunham Theater & Gallery in Brattleboro,...

[Read the whole post on]

OUR VALUED CUSTOMERS: While discussing movies...

Open Culture: Arthur Conan Doyle Names His 19 Favorite Sherlock Holmes Stories


Sherlock Holmes has become such a cultural fixture since he first appeared in print that all of us have surely, at one time or another, considered reading through the London detective’s complete case files. But where to start? One can always begin at the beginning with that first print appearance, Sir Arthur Conan Doyle’s 1887 novel A Study in Scarlet. But how best to progress through the Sherlock Holmes canon, a body of 56 short stories and four novels (and that number counting only the material written by Conan Doyle himself), some more essential than others?

You might consider reading the adventures of Sherlock Holmes according to the preferences of Sherlock Holmes’ creator. We know these preferences because of a 1927 competition in The Strand Magazine, where the character’s popularity first blew up, which asked readers to name the twelve best Sherlock Holmes stories. They asked Conan Doyle the same question, and the list he came up with runs as follows:

  1. “The Adventure of the Speckled Band” (“a grim story” that “I am sure will be on every list”)
  2. “The Redheaded League”
  3. “The Adventure of the Dancing Men” (due, as with “The Redheaded League,” to “the originality of the plot”)
  4. “The Final Problem” (“we could hardly leave out the story which deals with the only foe who ever really extended Holmes, and which deceived the public (and Watson) into the erroneous inference of his death”)
  5. “A Scandal in Bohemia” (since, as the first short story in the series, “it opened the path for the others,” and “it has more female interest than is usual”)
  6. “The Adventure of the Empty House” (“the story which esssays the difficult task of explaining away the alleged death of Holmes”)
  7. “The Five Orange Pips” (“though it is short it has a certain dramatic quality of its own”)
  8. “The Adventure of the Second Stain” (for its treatment of “high diplomacy and intrigue”)
  9. The Adventure of the Devil’s Foot” (“grim and new”)
  10. “The Adventure of the Priory School” (“worth a place if only for the dramatic moment when Holmes points his finger at the Duke”)
  11. “The Musgrave Ritual” (for its inclusion of “a historical touch which gives it a little added distinction” and “a memory from Holmes’ early life”)
  12. “The Reigate Squires” (in which “on the whole, Holmes himself shows perhaps the most ingenuity”)

He later added seven more favorites, including some he’d written after The Strand‘s contest took place:

  1. “Silver Blaze”
  2. “The Adventure of the Bruce-Partington Plans”
  3. “The Crooked Man”
  4. “The Man with the Twisted Lip”
  5. “The Greek Interpreter”
  6. “The Resident Patient”
  7. “The Naval Treaty”

“When this competition was first mooted I went into it in a most light-hearted way,” wrote Conan Doyle, “thinking that it would be the easiest thing in the world to pick out the twelve best of the Holmes stories. In practice I found that I had engaged myself in a serious task.” And those who call themselves Sherlock Holmes enthusiasts know that, though they may have begun reading the stories with an equally light heart, they soon found themselves going deeper and deeper into Holmes’ world in a much more serious way than they’d expected. Starting with Conan Doyle’s selections may set you down the very same path; when you finally come out the other side, feel free to name your own top twelve stories in the comments below.

For a quick way to read Conan Doyle’s Sherlock Holmes stories, get The Complete Sherlock Holmes.

Related Content:

Download the Complete Sherlock Holmes, Arthur Conan Doyle’s Masterpiece

Arthur Conan Doyle Discusses Sherlock Holmes and Psychics in a Rare Filmed Interview (1927)

Hear the Voice of Arthur Conan Doyle After His Death

Read the Lost Sherlock Holmes Story That Was Just Discovered in an Attic in Scotland

Watch John Cleese as Sherlock Holmes in The Strange Case of the End of Civilization as We Know It

Download 55 Free Online Literature Courses: From Dante and Milton to Kerouac and Tolkien

Colin Marshall writes elsewhere on cities, language, Asia, and men’s style. He’s at work on a book about Los Angeles, A Los Angeles Primer, the video series The City in Cinemaand the crowdfunded journalism project Where Is the City of the Future? Follow him on Twitter at @colinmarshall or on Facebook.

Arthur Conan Doyle Names His 19 Favorite Sherlock Holmes Stories is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

Daniel Lemire's blog: Secular stagnation: we are trimming down

Economists worry that we have entered in a secular stagnation called the Great Stagnation. To summarize: whereas industrial productivity grew steadily for most of the XXth century, it started to flatten out in the 1970s. We have now entered an era where, on paper, we are not getting very much richer.

Houses are getting a bit larger. We can afford a few more clothes. But the gains from year to year are modest. Viewed from this angle, the stagnation looks evident.

Why is this happening? Economists have various explanations. Some believe that government regulations are to blame. Others point out that we have taken all the good ideas, and that the problems that remain are too hard to solve. Others yet blame inequality.

But there is another explanation that feels a lot more satisfying. We have entered the post-industrial era. We care less and less about producing “more stuff” and we are in a process of trimming down.

Young people today are less likely to own a car. Instead, they pay a few dozen dollars a month for a smartphone. They are not paying for the smartphone itself, they are paying for what it gives them access to.

Let us imagine the future, in 10, 20 or 30 years. What I imagine is that we are going to trim down, in every sense. People will own less stuff. Their houses won’t be much larger. They may even choose not to own cars anymore. They may choose to fly less often. If we are lucky, people will eat less. They may be less likely to be sick, and when sickness strikes, the remedy might be cheaper. They will use less power.

We are moving to a more abstract world. It is a world where it becomes harder to think about “productivity”, a concept that was invented to measure the output of factories. What is the “productivity” of a given Google engineer? The question is much less meaningful than if you had asked about the productivity of the average factory worker from 1950.

Suppose that, tomorrow, scientists discover that they have a cure for cancer. Just eat some kale daily and it will cure any cancer you have (say). This knowledge would greatly improve our lives… we would all be substantially richer. Yet how would economists see this gain? These scientists have just made a discovery that is almost without price… they have produced something of a very great value… how is it reflected in the GDP? Would you see a huge bump? You would not. In fact, you might see a net decrease in the GDP!

We won’t cure cancer next year, at least not by eating kale… but our lives are made better year after year by thousands of small innovations of this sort. In many cases, these cannot be measured by economists. And that’s increasingly what progress will look like.

Measuring progress in a post-industrial world is going to get tricky.

Saturday Morning Breakfast Cereal: Saturday Morning Breakfast Cereal - Colossal

Hovertext: Tomorrow, Giraffe vs. Boat.

New comic!
Today's News:

 Hey, geeks!  If you're coming to BAHFest Seattle, please check in on our facebook page. Thanks!

Colossal: Glistening Snail Shells Painted on a Crumbling Croatian Facade by ‘Lonac’




Croatian artist Lonac recently finished work on this trio of snails painted on a dilapidated building in his hometown of Zagreb. Titled “Xenophora,” the mural depicts three photorealistic carrier snails pinned to the edges of the old building creating a compelling contrast between old and new. The piece was created for the Rendezvous Festival and you can see more views and process shots on his website. (via StreetArtNews)

Michael Geist: Canada Caves on Copyright in TPP: Commits to Longer Term, Urge ISPs to Block Content

The final Trans Pacific Partnership intellectual property chapter leaked this morning confirming what many had feared. While the Canadian government has focused on issues like dairy and the auto sector, it caved on key copyright issues in the agreement. As a result, works will be locked out of the public domain for decades at a cost to the public of hundreds of millions of dollars. Moreover, the government will “induce” Internet providers to engage in content blocking even where Canadian courts have not ruled on whether the content infringes copyright. As a result (and as expected – this was raised years ago), the government’s “made in Canada” approach to copyright – which it has frequently touted as representing a balanced approach – faces a U.S. demanded overhaul.  In fact, even as other countries were able to negotiate phase-in periods on copyright changes, the Canadian negotiators simply caved.

The biggest change is a requirement to extend the term of copyright from life of the author plus 50 years to life plus 70 years. The additional 20 years will keep works out of the public domain for decades. The New Zealand government estimates that this change alone will cost NZ$55 million per year for a country that is one-ninth the size of Canada. Moreover, New Zealand was able to negotiate a delayed implementation of the copyright term provision, with a shorter extension for the first 8 years. It also obtained a clear provision that does not make the change retroactive – anything in the public domain stays there. Malaysia also obtained a delay in the copyright term extension requirement.

Canada, on the other hand, simply caved.  The cost to Canadians will be enormous. If the New Zealand’s estimate is accurate, the cost to the public alone will easily exceed $100 million per year. Hundreds of well known Canadian authors and composers who died years ago will not have their work enter the public domain for decades.

The public domain provision is not the only loss for Canada on copyright. The Canadian government was able to preserve the notice-and-notice system for Internet providers, but at a very high price. Canada has now agreed to induce providers to “remove or disable” access to content upon becoming aware of a decision of a court of a copyright infringement. The broadly worded provision could force Canadian ISPs to block content on websites after being notified of a foreign court order – without first having to assess whether the site is even legal under Canadian law.

Canadian negotiators caved on a wide range of other issues. For example, it has increased the criminalization of copyright, adding new criminal liability for the removal of “rights management information” (rules associated with Canada’s controversial protection of digital locks) and it has expanded restrictions on the importation or distribution of goods whose rights management information has been altered. It has expanded border measures rules (just months after passing legislation on the issue), by agreeing to notification system on suspect in-transit shipments that will not even enter Canada.

There is much more to study, but the first reaction to the TPP intellectual property chapter is that Canadian negotiators have agreed to significant changes to Canadian copyright law without an opportunity for public comment or discussion. Given that there was a two-tier approach for the trade talks with insider access and that U.S. lobby groups identified the TPP as a mechanism to extend Canadian copyright term, the outcome is disappointing but not surprising. Unlike other countries that were able to negotiate delayed implementation, however, Canada simply caved to U.S. pressure, seemingly willing to trade away Canadian copyright policy.

The post Canada Caves on Copyright in TPP: Commits to Longer Term, Urge ISPs to Block Content appeared first on Michael Geist.

The Rhizome Frontpage RSS: October 22 at the New Museum and Livestreamed: Blockchain Horizons

PWR Studio, #1 (trustless), 0x9ab9f7a4b85412bfbe2f4f63b1c98808851c4f32, Tongersestraat 42a, Maastricht, NL, 9/10 2015. Photograph of Bitcoin mining rig. Courtesy of the artists.

Blockchain Horizons
Thursday, October 22, 2015 at 7pm
at the New Museum, 235 Bowery, NYC
and livestreamed at

Blockchains are distributed databases, secure and transparent by virtue of peer-to-peer communities that cryptographically validate each entry. As the technology behind cryptocurrencies like Bitcoin, the blockchain has given rise to divergent speculations about the future of politics and finance outside of direct state control, from collective utopias to sublime dystopias.

Organized by Rhizome's Artistic Director, Michael Connor, "Blockchain Horizons" convenes artists, critics, and entrepreneurs to discuss the cultural implications of this technology for publishing, licensing, and distribution. In doing so, it treats the blockchain as social fact rather than science fiction.

Participants include Kevin McCoy, artist, entrepreneur, and founder of Monegraph, a blockchain-based solution for attributing and distributing art, conceived of at Seven on Seven 2014 and currently a member of NEW INC.; Berlin-based PWR Studio (Hanna Nilsson & Rasmus Svensson), who are developing a decentralized platform for publication and distribution of digital texts; and Rachel O'Dwyer, a Dublin-based researcher and curator with a focus on the political economy of communications, digital currencies and media cultures. In addition, Nora Khan, DeForrest Brown, and The Actual School will present a work-in-progress online project titled Futures Along the Blockchain. Conceived by Lars Holdhus and commissioned by Rhizome, the site convenes an online group discussion about the blockchain and proposes applying it to questions of music distribution.

Rhizome's public programs are made possible, in part, through the support of the Andy Warhol Foundation for Visual Arts, the Carolyn K. Tribe Foundation, the New York City Department of Cultural Affairs, and the New York State Council on the Arts.

All Content: NYFF: "Carol," "The Assassin," "Right Now, Wrong Then"


Film festivals have an odd push-pull relationship with exclusivity. As Godfrey mentioned in his last dispatch, we were treated to Danny Boyle’s rather remarkable "Steve Jobs" (almost more marathon than movie), after the audience at Telluride got first dibs, but Boyle was quick to assure us that we were seeing the final cut. Telluride had seen something else. New York was getting the real thing. We do thrive on that feeling, don’t we? That we were first, that we’re special. Thankfully the films can give us that feeling regardless of when we see them. It didn’t matter a whit that I waited four months to watch Todd Haynes’ "Carol" after the first round of critics got their eyes on it at Cannes. A film like "Carol" overrides earthly concerns like time and envy. It rushes through you like a one-of-a-kind endorphin, coating your veins and synapses in velour on the way to your brain. You could see it ten years from now and your reaction to it would be unchanged. Though the context in which you watch it may prove important.

For newcomers, it’s the story of a woman (Rooney Mara) who falls for someone who appears to be the first strong sexual presence she’s ever encountered. That this person happens to be Cate Blanchett at the height of feline intensity (someone give her an award already; this is her best work), at a time when "civilization" was still getting used to the idea of homosexuality, presents more than a few problems for both parties.

Our own Barbara Scharres gave "Carol" a thorough going over at Cannes
, explaining why it didn’t work for herthat Haynes offered no sense of the lives its heroines lead before we meet them, and I’ve read this complaint elsewhere. I understand it to a degree, but both Haynes’ images and Mara and Blanchett’s precise body language tell me everything I need to know about the interior life of these characters. It helps I think, that this film, which speaks the language of the heart and the stomach more than the logical mind, represents a release of sorts for its creator. Haynes is an incredibly intelligent filmmaker and has in the past presented himself as a sort of homage engineer. He’s answered the question of how to best pay tribute to a subject, film or artist without being emotionally or representationally vulgar. A film about Bob Dylan becomes a film about the idea of Bob Dylan through the narratives he’s presented of his own identity to the public. A remake of "All That Heaven Allows" becomes a way to shift the dynamic in order that it remain both distant enough from the original and still relevant to both past and present. And all these solutions are fascinating and have made for very impressive work, but there’s always been a sense of the intellectualization of aesthetics and theme getting in the way of the emotional potential of each subject. I never leave less than totally aware how each film’s milieu or idea effected Haynes development as an artist, but that’s not enough to garner repeat viewings. He’s apparently applied that remarkable brain of his to the problem of how to let me become invested in his protagonists because I fell head over heels in love with "Carol."

It’s a film of real, relatable moments presented as the most important aspects of its characters lives together, which is why I didn’t need Haynes to explain to me who Therese and Carol were. The way they act in public vs. the way they act when they’re alone with each other tells me everything. The way Therese leans in to smell Carol’s perfume. The way they want to respect (and not respect) each other’s privacy, even as they yearn not to. The way Therese’s eyes light up (Mara’s eyes are her greatest asset) when she thinks she might be drawn further into Carol’s orbit. Ed Lachman’s photography presents them like a pair of phoenixes, rising from the dusty mores of Eisenhower’s America. 

Two documentaries playing the festival dovetail with "Carol’s" dual leads—"The Witness" (covered by Godfrey) draws a portrait of a young woman’s awakening sexuality in New York before it’s tragically cut short. "Ingrid Bergman: In her Own Words," about the jaw-dropping actress, was also sort of put on trial for her infidelity in America as Carol is by her husband (the ever-dependable Kyle Chandler). There’s even a little of "Don’t Blink: A Film About Robert Frank," in Therese’s interest in photography. These coincidental reference points are a sign of Haynes relinquishing his ideological hold on the subtext of his movies. Ten years ago, Haynes would have drawn these conclusions for us. He’s rightly confident in "Carol’s" power as drama to let its cathartic rush be entirely on romantic terms. He knows that most everyone in the audience will have felt these feelings, in some form or other. There’s no need to comment on longing—it’s universal. 

I had a similar feeling watching Hou Hsiao-Hsien’s "The Assassin," the Taiwanese master’s latest in almost a decade. The director spoke about wanting to find the reality in the fantastic conventions of the Wuxia genre at the Q&A following the press screening. It’s fair to say he’s done just that, but more accurate to say he found his own truth by treating the past with the same grace he’s always granted the present. In the film, Shu Qi plays a killer sent to murder an official (Chen Chang) with whom she shares a past. That turns out not to matter because "The Assassin" is like a painting that dances to life. Hou’s images are at once stark and silky, shifting focus and centrality, welcoming intrusions from heavy bodies and weightless natural splendour. Psychologies are slowly revealed, like the complexities of the plot, but both are hardly as important as the way Shu Qi stands, the way she makes a fist, the way her clothing seems to have been tailored to make room for her soul rather than her body. Hou is guided by a spiritual femininity in his discursive montage, his attention to details and movement rather than events. It reminded me of Chantal Akerman, who used to stare at the behavior of women with the same unwavering yet unspoken support. There were moments in both "The Assassin" and "Carol" where I found myself dumbfounded by the joy of watching flawless technique. I could do little but try to keep from laughing. I was so giddy from the highs of both films that I could hardly contain myself. 

At this point in the festival I welcomed the rush of images, because my brain is bent out of shape by the rigourous schedule. Interviews and early screenings cutting into an already negligible sleep schedule are every journalist’s lot. Add to that chaotic variables like the tragic passing of Akerman, the quitting of my stressful day job and looking for another. In short, there’s a no-vacancy sign lit up in the part of my mind that welcomes dissonance and oblique exercises. Which is why I’m glad I caught Hong Sang-Soo’s "Right Now, Wrong Then" (or "Right Then, Wrong Now") over a week ago. I don’t know that I’d still be in the mood for its melancholy duelle. At the time, however, I knew I was watching something special. Hong’s just as fiercely smart as Haynes, though they play different games. Hong’s been stimulated the last few years through chronological deck shuffling and dream-logic. "Right Now, Wrong Then" is perhaps his most satisfying outright experiment in that it finds the same truth despite variations in the orchestration of events. 

For the first hour we watch a director meet a woman and try to woo her at her studio, a bar and a party. They part ways in time for the director to attend a disastrous Q&A at a local film festival. Then Hong hits the reset button and plays the same events again, allowing for minute differences in their interactions which alter the conclusion of their meeting in a meaningful way. Hong lets the scenario—touching, sad and funny both times—gently play out and lets us see that human behavior can appear to change depending on slight changes. The director isn’t presented as a better or worse person, just more or less able to control his social honesty. What’s hilarious is seeing how some of his most appalling behavior can wind up having had no impact on his fortune, while a white lie titanically shifts the course of his day. Hong hasn’t changed a line of his aesthetic playbook in the last five years and as long as the results are this sweet and funny, he never needs to. 

All Content: Knock Knock


A couple of sexy, scantily clad and soaking wet young women knock on the door of a happily married, middle-aged husband and father of two—who happens to be home alone on a long, holiday weekend—in Eli Roth’s “Knock Knock.”

The words “Eli Roth” in front of the title should tell you that it won’t just be about illicit, titillating fun, followed by an obligatory bit of remorse. But this time, the longtime horror director doesn’t go for the gore the way he gleefully did in his early films (“Cabin Fever,” “Hostel”). Instead, he aims to disturb us on a deeper level: He wants to hit us where we live. Literally.

Roth’s film, which he directed and co-wrote, is an update of a trashy little exploitation flick called “Death Game” from 1977. (The two actresses who were its stars, Sondra Locke and Colleen Camp, get producing credit here while Camp appears in a brief supporting role as a nosy friend). His intention, he says in the film’s press notes, was to demonstrate how much more quickly we experience everything in the social media age—both the delights and the torments—and how the rules of civilized society no longer seem to apply.

But he makes his point far clearer in the notes than he does in the movie itself. Roth skillfully builds tension until the moment when everything snaps and goes insane, followed by a series of shrill and repetitive scenes of increasing torture and destruction, all of which leads to The Big Reveal of what inspired these vicious games. As a piece of social satire, “Knock Knock” winds up being not just toothless but anticlimactic.

But it does feature Keanu Reeves, who’s game for all the craziness that comes his way in the leading role. He stars as Evan, an architect living in a coolly sprawling minimalist home filled with colorful, modern art in the hills outside Los Angeles. Roth sets the mood rather elegantly off the top, with long, gliding camerawork over the Hollywood sign, through Malibu canyons and down serene, suburban streets until he winds up at Evan’s front door. Clearly, this is an idyllic place—which the presence of Evan’s flirty, artist wife (Ignacia Allamand) and adorable son and daughter confirms. Nothing could possibly go wrong here.

There almost seems to be an intentional awkwardness to these early interactions between Evan and his family; they’re too happy and perfect, like folks you’d see forced together in a catalog. At first, it's as if Roth and co-writers Nicolas Lopez and Guillermo Amadeo are toying with the notion of domestic bliss, only to hold it up to the light, examine it and crush it to pieces later on. The execution never feels quite so focused, however.

With the wife and kids away on a beach trip, Evan uses the weekend to catch up on a project, enjoy some red wine, maybe smoke a little pot and listen to his treasured vinyl on the turntable. But then, there’s a knock at the door on the one night there happens to be a torrential downpour in drought-stricken Southern California. Standing on his front porch, giggling and dripping in itty-bitty clothing, are the brunette Genesis (Lorenza Izzo, Roth’s real-life wife) and blonde Bel (Ana de Armas), who must be half his age.

The two friends insist innocently that the cab dropped them off in the wrong spot on the way to a party, and now they’re lost, so could they please come in and use the phone? And maybe take off their clothes and throw them in the dryer? As Julianne Moore says so drolly in “The Big Lebowski” while showing Jeff Bridges the porno movie “Logjammin’”: “Lord, you can imagine where it goes from here.”

And it does go there—sort of—in time. The playful pals snuggle up in fluffy, white robes while waiting for their clothes to dry and the car service to arrive (which takes an estimated 45 minutes, conveniently). As they get friskier and more suggestive with Evan, he genuinely tries his best to be a gentleman and remain loyal—scooching over to a different chair, or going out of his way to compliment his wife’s sculptures. The first half of the film is far superior to the second, as Roth takes his time and keeps us guessing as to who these girls really are and what might happen. Reeves’ easygoing, low-key screen persona serves him well here and provides an intriguing contrast to Izzo and de Armas’ hypersexuality.

But then! And this really isn’t a spoiler, because something’s gotta give—something does give. Roth shoots the ménage a trois with surprising taste and restraint—and that’s the last moment of taste and restraint you’ll get from him. The next morning, “Knock Knock” shifts abruptly and becomes an insanely over-the-top version of Michael Haneke’s “Funny Games.” (Pick the version of your choice. There are two). Genesis and Bel reveal their true selves—we think—as noisy, destructive, overgrown children. And the trouble is, the change happens out of nowhere; they become crazy people too quickly, and the change in tone is jarring.

More problematic: Because their characters become so unbelievable in the extent to which they make Evan’s life a living hell, it’s impossible to become truly frightened by their actions or threats. They’re more screechy and annoying than anything else, like bratty tweens jacked up on sugar and caffeine. Reeves, meanwhile, eventually amps up (and camps it up) as well, delivering a long and profane tirade while tied to a chair with an electrical cord.

I was a good guy! I’m a good father!,” he screams and spits in vain, reminiscent of Nicolas Cage’s awesomely outlandish work at the end of Neil LaBute’s “Wicker Man” remake. That one moment suggests the cult B-movie that “Knock Knock” could have been. Instead, the ending—with its revelation of what these girls were really after all along—is so frustrating, you’re likely to wonder: Is that all there is?

All Content: Victoria


“Victoria” is a breathtaking technical accomplishment. It’s right there in the tagline—“One City. One Night. One Take.” For 138 minutes, Sebastian Schipper and his cast filmed the entirety of “Victoria,” reportedly only doing the entire piece a few times and picking the best one. In other words, there are no “cheats” here. No hidden cuts when a door closes or someone walks by a suspicious wall. It is literally one take, and it takes place all over Berlin, at night, even developing into an intense action movie. Sadly, the second half of “Victoria” isn’t as breathtaking as the first, as characters are forced to make some unbelievably dumb decisions just to fit into the one-take structure, almost leading one to question if there isn’t a better version of “Victoria” that allowed for two or three takes.

The best thing about “Victoria” isn’t actually its technical prowess—it’s the lead performance from the mesmerizing Laia Costa as the title character. She holds the camera from first frame to last as Schipper doesn’t leave her perspective on what will surely be one of the most unforgettable nights of this young woman’s life. Victoria is on holiday in Berlin. We meet her clubbing in one of the major city's many hotspots—an underground dance hall with no windows. On her way out, likely to another club, Victoria meets a quartet of guys, and they naturally take notice of this vibrant, beautiful young lady. Sonne (Frederick Lau) strikes up a flirtation, and the first half of “Victoria” actually plays more like one of Richard Linklater’s “Before” movies than one might expect. Victoria and Sonne do a lot of walking and talking, Sebastian Schipper and cinematography Sturla Brandth Grovlen’s camera circling around this likable pair. Their conversations feel heartfelt and genuine, particularly one in a closed café at right around the hour mark.

And that’s where “Victoria” turns a corner. One of the guys in Sonne’s group ends up getting drunk enough to essentially become useless, and we learn that these guys have some unexpected plans for the evening. Rather surprisingly, “Victoria” becomes a heist film as our quiet protagonist has to become a getaway driver. Schipper’s camera movements get more hectic, the film gets more impatient, and it essentially turns into an action film. It’s interesting to watch how even in a one-take film, form impacts content. There’s no room for editing, but choices are still being made here, as the form often mimics the mood. It’s jubilant and fluid in club scenes; panicked and shaky when that reflects the character’s state of being. The camera itself becomes a character in “Victoria,” someone else on the journey of this unforgettable night. It doesn’t so much feel like we’re reflecting Victoria’s perspective as much as we’re another member of the party, someone who doesn’t want to leave our heroine alone in this dangerous city.

Costa is simply perfect here. Watch the way her eyes convey the emotion of the moment, whether or not it’s in the cautious flirtation with Sonne or the fear of the second act. She’s often an observer to the insanity of what’s going on around her, and she does so much internally, embodying the character in ways that were likely dictated by the form. She’s not allowed the escape of setting up another shot or altering performance over multiple takes. It makes for a deeply honest, genuine performance.

Sadly, the film kind of lets her down at a certain point. The pace sags significantly at around the 90-minute mark and never quite recovers from it with 48 minutes to spare. Like a lot of nights out on the town in major cities in our twenties, it goes on just a bit too long, getting exhausting before it’s over. And yet it’s easy to remember and focus on the highlights, which are plentiful for at least the running time of an average movie. If anything, the greatest accomplishment of “Victoria” is that you stop wondering how it was done and experience the characters and their incredible journey. It becomes less a movie about one take and more a movie about one character.

BOOOOOOOM!: Photographer Spotlight: Antoine Henault


Photos by French photographer Antoine Henault. More images below.

Open Culture: NBC University Theater Adapts Great Novels to Radio & Gives Listeners College Credit : Hear 110 Episodes from a 1940s eLearning Experiment


Creative Commons image by Joe Haupt

Before the internet became our primary source of information and entertainment—before it became for many companies a primary revenue stream—it promised to revolutionize education. We would see a democratic spread of knowledge, old hierarchies would crumble, ancient divisions would cease to matter in the new primordial cyber-soup where anyone with entry-level consumer hardware and the patience to learn basic HTML could create a platform and a community. And even as that imagined utopia became just another economy, with its own winners and losers, large—and free—educational projects still seemed perfectly feasible.

These days, that potential hasn’t exactly evaporated, but we’ve had an increasing number of reasons—the threatened status of net neutrality prominent among them—to curb our enthusiasm. Yet as we remind you daily here at Open Culture, free educational resources still abound online, even if the online world isn’t as radical as some radicals had hoped. Frequently, those resources reside in online libraries like the Internet Archive, who store some of the best educational material from pre-internet times—such as the NBC University Theater, a program that comes from another transitional time for another form of mass media: radio.

Before payola and television took over in the fifties, radio also showed great potential for democratizing education. In 1942, at the height of the Golden Age of Radio, NBC “reinaugurated” a previous concept for what it called the NBC University of the Air. “Throughout the mid-1940s,” writes the Digital Deli, an online museum of golden age radio, “NBC produced some twenty-five productions specifically designed to both educate and entertain. Indeed, many of those programs were incorporated into the curricula of high schools, colleges and universities throughout the U.S. and Canada.”

After 1948, the program was retooled as NBC University Theater, then simply NBC Theater. “Irrespective of the title change,” however, the program “continued to maintain the same high standards and continued to expand the number of colleges offering college credit for listening to and studying the programs’s offerings.” Digital Deli has the full details of this proto-MOOC’s curriculum. It consists of listening to adaptations of “great American stories,” great “world” stories–from Voltaire, Swift, and others–and adaptations of modern American and British fiction and “Great Works of World Literature.”

In short, the NBC University Theater adaptations might substitute for a college-level literary education for those unable to attend a college or university. In the playlist above, you can hear every episode from the show’s final run from 1948 to 1951. We begin with an adaptation of Sinclair Lewis’s Main Street and end with Thomas Hardy’s “The Withered Arm.” In-between hear classic radio drama adaptations of everything from Austen to Faulkner and Hemingway to Ibsen. There are 110 episodes in total.

Each episode features commentary from distinguished authors and critics, including Robert Penn Warren, E.M. Forster, and Katherine Anne Porter. “Apart from the obvious academic value” of the series, writes Digital Deli, “it’s clear that considerable thought—and daring—went into the selections as well.” Despite the tremendous increase in college attendance through the G.I. Bill, this was a period of “rising hostility towards academics, purely intellectual pursuits, and the free exchange of philosophies in general.”

The ensuing decade of the fifties might be characterized culturally, writes Digital Deli, as an “intellectual vacuum”—anti-intellectual attitudes swept the country, fueled by Cold War political repression. And radio became primarily a means of entertainment and advertising, competing with television for an audience. Quality radio dramas continued—most notably of excellent science fiction. But never again would an educational program of NBC University Theater‘s scope, ambition, and radical potential appear on U.S. radio waves.

Related Content:

Hear the Very First Adaptation of George Orwell’s 1984 in a Radio Play Starring David Niven (1949)

Hear Aldous Huxley’s Brave New World and 84 Classic Radio Dramas from CBS Radio Workshop (1956-57)

Dimension X: The 1950s SciFi Radio Show That Dramatized Stories by Asimov, Bradbury, Vonnegut & More

Free: Listen to 298 Episodes of the Vintage Crime Radio Series, Dragnet

Josh Jones is a writer and musician based in Durham, NC. Follow him at @jdmagness

NBC University Theater Adapts Great Novels to Radio & Gives Listeners College Credit : Hear 110 Episodes from a 1940s eLearning Experiment is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

BOOOOOOOM!: Video of the Day: “Stuff that Sounds like Autumn” by Fragmento Universo


Great instalment of Fragmento Universo’s ‘Stuff that Sounds like’ series. Fragmento Universo is a Madrid-based operation, run by filmmakers Tessa Dóniga and Christian del Moral. Watch their highly satisfying video below!

Professor Fish: CS intro != Programming intro

Yes, "CS intro != Programming intro". Of course, it is not; maybe it would never occur to you that it could!? Well, in some places, though, the CS 101 ("introduction to CS") course ends up being essentially that, at least for some initial part. In some places (Koblenz included; see my OOPM course which is under attack in this post), the CS 101 course certainly ends up trying to also introduce the basics of programming (because the lecturer thought he/she should).

Here is why I think this is wrong and I apologize for coming forward so late:

  • Teaching the trivial level of programming ("getting you going with for-loops and such" :-)) just doesn't belong at the university. Maybe it never belonged there, but it certainly doesn't belong there anymore (for like 10-20 years) because it is just such a basic skill and there is so much guidance out there (Youtube etc.) that a contemporary student wanting to study CS must (or should) simply be beyond the point of needing such a trivial introduction.
  • At a "mediocre" university like mine (not overwhelmed exactly with brilliant students like this), we may get some otherwise possibly smart students however certainly lacking the most basic programming skills. Trying to get them up to speed in a university-style course is just frustrating everyone. It certainly has bored me near to death.
As a result, I am changing my CS 101 course (11 ECTS on paper, which is crazy in itself), per immediately (effective per end of October), as follows:
  • I decouple the objective of teaching basics of programming from other aspects of the course by running two tracks in parallel for some time. I collect these other aspects of the course, which are not about basics of actual programming, as the "theory track". The "programming track" is just there for those who need it. I expect it to be skipped by some students. The theory track will not make any assumptions about previous programming skills.
  • In the theory track, I spend several weeks overall on algebraic specification with applications to abstract data types and what is maybe best called "algebraically oriented domain modeling". See my recent slide deck (.pdf), in that instance Haskell-focused, though. This is joint work with Magne Haveraaen, University of Bergen. Welcome to the university! Students need to understand algebraic signatures and logic formulae. I am going to be nice with the students :-) So I shall limited coverage to pragmatic application of loose algebraic specifications; no term algebra, no quotient algebra, no Herbrand universe, no nothing. Structural induction is in, though! Sorry.
  • As the two tracks have progressed enough, synergy happens such that we implement specifications in Java or Python. Appropriate axioms from the algebraic specifications will lend themselves as assertions and as (parametrized) unit tests. We are also well equipped to discuss design by contract. We will also be prepared to appreciate the beauty (?) of UML class diagrams with OCL constraints. Algebraic specifications and logics are everywhere.
  • Logistically, I will be working mostly without slides. Rather I will use the whiteboard and different editors. The 101wiki of the 101companies project will host code and explanations and links to Wikipedia and other online resources. I will distribute some lectures notes, but no wall of text is going to replace my previous wall of slides. I want to get across (through focused lecture note material) some basic notions and for the rest I use online resources including commented specifications and programs as well as links to Wikipedia et al.
This gets us through 2/3 of the course. The remaining 1/3 of the course will use a single, sequential timeline. I will think about it, as it gets closer, but here are some thoughts:
  • Coverage of EBNF as another modeling method. Great! There is this wonderful connection between algebraic signatures and context-free grammars. Maybe, I will do term algebras anyway and manage to bore everyone to death.
  • Very basics of complexity theory. This can be done as soon as students are fluent in basic algorithmic programming. The same is true for the very basics of program verification. Coverage of program verification (Hoare logic) will definitely benefit from dealing with logic formulae in the theory track earlier.
  • There is a bunch of non-very basic programming topics that I tend to cover such as pointers, encapsulation, interfaces, modularity, inheritance, generics, exceptions. Some order needs to be determined. I have managed in the past.

Luckily, in the second semester, I teach "introduction to functional programming".  It is, of course, wonderful (in the view of the lecturer anyway) to make the students see the connection between algebraic specification and functional programming.

Computer Science: Theory and Application: Best place/online resource to learn more Theory?

I have been programming in C# since April 2015, making websites with HTML/CSS since 2013 and am currently learning JavaScript, however my lack in basic theory is starting to hinder my ability to understand more complex algorithms. Does anyone have any resources that they could throw at me? I don't have a programming job or anything (As of now, hoping to change that in the future) I am just doing side projects for fun. Not only do i want to learn it so i have a better grasp of things, but it just generally seems interesting and something i want to know more about. Thanks in advance for the help! :)

submitted by sloansta
[link] [6 comments]

BOOOOOOOM!: Video Profile: Michelle Pezel of Antisocial


Huck Magazine just released a great portrait of Michelle Pezel of Antisocial Skateboard Shop, which she owns with pro skater Rick McCrank. My pal Alana Paterson snapped some beautiful photos for the mag and Benny Zenga shot the video below!

programming: TIL: github has file finder activable by pressing t

submitted by aukkras
[link] [89 comments]

things magazine: Swarming

Fukushima, a photographic and text essay by Arkadiusz Podniesinski / abandoned Russia by Ralph Mirebs / illustrations by Guillaume Kurkdjian / maps by Stephen Walter / is this the end of Bugatti? VW looks to cut costs / the blackest black is Vantablack / The Abandoned City, photographs by Peter Zelei / The Wayback Machine: nostalgia, music and the changing role of the past for the digital generation.


‘Life is too short for ugly cars’: Chromjuwelen (via Coudal) / new music! LIINES ; Blac Rabbit ; Charivari / there’s something creepy about the products sold by Bugs Direct, and not just because they were once crawling / ‘Julian Germain photographed classrooms in 19 countries all over the world‘, at the British Journal of Photography / interactive map of global satellite positions (via flight club).



4 Channel Infrared (IR) Remote is a simple project using the popular  HT12A and HT12D encoder / decoder chips from Holtek.


  • Supply – Transmitter: 2.4 ~ 5 VDC, 5 V @ 20 mA & Receiver: 5 ~ 6 VDC, 5 V @ 50 mA
  •  Output – 4 Latched/Momentary TTL compatible outputs
  •  Crystal based oscillator for reliability of operation
  •  DIP switch selectable 8 bit address code
  •  LED output to indicate reception
  •  ON/OFF slide switch in the transmitter
  •  Power-On LED indicator in the Receiver / Transmitter
  •  High noise immunity
  •  Berg connector for interfacing of the board
  •  Four mounting holes of 3.2 mm each
  •  PCB dimensions – Transmitter: 61 mm x 47 mm & Receiver: 46 mm x 46 mm


The post 4 CHANNEL INFRARED REMOTE MODULE appeared first on Electronics-Lab.



Quirky vignettes start to merge together in this super imaginative short by California-based creative duo Corey Creasey and Ian Kibbey (a.k.a. Terri Timely). Watch the full video below!

Computer Science: Theory and Application: Australian researchers build first two-qubit logic gate in silicon (Nature)

submitted by gnzlbg
[link] [13 comments]

Electronics-Lab: Transient Voltage Suppressors

Voltage suppressors are used to protect circuits from unwanted transients, when other devices like diodes and capacitors fail to do so. Transient effects have various sources and are able to damage the connected parts and ICs if not properly measures taken. In this article we will discuss about the various transient voltage suppressors and their uses. We will cover, TVSs, Varistors, Multilayer Varistors, Surgestors and Polyswitches etc.

Bypass Capacitors


Bypass capacitors are very often used in logic and power systems to reduce unwanted voltages to reach ICs and other sensitive parts and to clean the power rails, but are limited to low power applications such as RC snubbers and decoupling of digital logic rails. For decoupling a digital rail a capacitor in the range of 0.01-0.22uF is often used and for decoupling a power rail a 0.1uF and up is used, connected form power line to ground. Capacitors are low cost, simple to apply, have fast action and are bipolar but have uneven suppression and may fail unpredictably.

Zener Diodes


Zener diodes are also used to protect sensitive circuits from unwanted voltages in a way of clamping low energy systems that run at high frequencies such as high speed data lines. They are low cost, fast in action, have specific clamping voltage, they are easy to be used and work bidirectional, but can only handle low energy and fail open (which can hurt the circuit). They are mostly used for regulation than transients.

Transient Voltage Suppressor Diodes (TVS)


Transient voltage suppressor diodes or TVSs are semiconductor devices used to clamp transient voltages and current, such as electrostatic discharge, inductive switching kickback, induced lighting surges etc. TVS are used for diversion or clamping in low voltage and low energy, modest frequency systems and are way more reliable than a diodes. They come in unipolar and bipolar versions. Unipolar TVS breaks down when the specified breakdown voltage is exceeded and pass current in one direction, in the opposite direction of the arrow. In contrast bipolar TVS can handle current in both directions. TVS are invisible to the circuit they are placed to until a transient appears. When a transient appears, TVS clamps instantly to limit the spike to a safe voltage level. The breakdown voltage of TVS should be selected to have a breakdown voltage greater than the working voltage of the circuit protecting. Some of the advantages of TVS is that they are fast, easy to use and fail with short-circuit. Some of the disadvantages is that their high capacitance limits the frequency they can be used, they can be used in low energy systems and are more expensive than Zener diodes and MOVs.

Metal Oxide Varistors (MOVs)


Metal oxide varistor or MOV is a bidirectional semiconductor device that acts like a voltage sensitive variable resistor. It’s made of various metal oxide p-n junctions placed in various directions and when the voltage across its leads exceeds a specified voltage they appear to have a very small resistance. The breakdown voltage is defined during the manufacturing process and can pass current in both directions, so can be used in DC and AC circuits. MOVs are fast, low cost, easy to use and handle more power than TVS. Also when they fail they short circuit. The disadvantage of MOVs is that they have moderate to high capacitance, thus limiting their use in lower frequency systems. MOVs are usually placed across mains input along with a series filter inductor and a fuse to protect the MOV itself. When a transient appears they switch from high resistance to low resistance this passing the excess current through. They can absorb a large amount of power for short periods of time and smaller amount of power for longer periods.

Multilayer Varistor (MLTV)


Multilayer Varistor or MLTV is a surface mount variation of MOV. Due to the surface mount contacts MLTVs have lower self-inductance and series resistance allowing for much quicker response times, typically less than 1 ns. The energy rating of MTLV are lower than other types of varistors but they can survive many thousands of strikes at full rated peak current. They are used on low voltage (3-70V) systems with modest frequencies. They are fast, compact and bidirectional, but more expensive than other MOVs and their high capacity limits their use on high frequency systems.



The surgector uses a silicon thyristor technology to provide bidirectional “crowbar” clamping action for transients. Surgectors remain in a reverse bias state as long as the voltage across is it is below breakdown voltage. If a transient voltage appears then the device breakdowns beginning the clamping action. If the transient voltage rises higher until the breakover voltage is reached a thyristor action is triggered and the surgector latches to ON state, thus short circuiting the transient voltage.



A polyswitch is a positive temperature coefficient resistor that stops the current from passing when a specified temperature is reached. In normal temperatures the resistance is low and current passes through easily. When the current rises enough (trip current) then resistance is increased dramatically and current flow drops. The polyswith will reset if the holding current is reduced and the device is cooled to normal temperatures. They often used in speakers, power supplies, battery packs, motors etc. They are low cost and easy to use, but requires a cooling down period to reset.

Avalance Diodes


Avalance diodes are designed to break down and conduct at a specified reverse-bias voltage. Their operation is similar of a Zener diode but the breakdown occurs using the avalance effect. Unlike Zener diodes, avalance diodes are available with high breakdown voltages as high as 4000V. They are placed in circuit in reverse biased direction and in this state they don’t interfere with the circuit. If the voltage across it exceeds the breakdown voltage then the diode passes the excess current to ground. Avalance diodes are often used in low voltage, high speed logic applications and are very fast (<1ns response). Also their shunt capacitance is low (50pF).

Gas discharge and Spark Gap TVSs

Gas discharge and spark gap TVSs are used for diversion of current in very high energy and high voltage applications. Their high energy capability can go up to 20kA and their leakage current is in pA range. Disadvantages of them is that cost more than other methods and are slow in response.

Transient Suppressor Examples Uses

TVS examples




MOV Example


MTLV Example


Surgector Example


PolySwitch Example



The post Transient Voltage Suppressors appeared first on Electronics-Lab.

Computer Science: Theory and Application: Which software uses the Python 2.0 license?

Hey guys i am a computer science student from Greece and i have to write an essay on examples of software that use the Python 2.0 license.I would really appreciate if you knew any.

submitted by feelingwisesometimes
[link] [5 comments]

Open Culture: Animated Map Lets You Watch the Unfolding of Every Day of the U.S. Civil War (1861-1865)

The border-obsessed map animator known as Emperor Tigerstar views war from a distance. The Emperor leaves such details as journal entries, letters home, and tales of valor and cowardice for other history buffs.

His niche is meticulously clocking the defeat and triumph in terms of shifting territories, by year, by fortnight, and, in the case of World War I and World War II, by day.

His five minute take on the American Civil War, above, leaves out most of the hair-raising small scale skirmishes familiar from the pages of The Red Badge of Courage.

Trans-Mississippi Theater aside, it also makes plain how little ground the Confederates gained after 1861.

The Blue and the Gray are here represented by blue and red, with the mustard-colored disputed border states picking sides before the first minute is out. (The Union’s Naval Blockade is in formation within seconds.)


Maroon = Confederate States of America and territories

Red = Areas occupied by Confederate forces

Pink = Gains for that Day

Dark Blue = United States of America and territories

Blue = Areas occupied by Union forces.

Light blue = Gains for that day

Yellow = Border states / disputed areas.

The magnitude is moving, especially when paired with ground-level observations, be they fictional, historical or eyewitness.

Even the place-names on the map, which now were merely quaint, would take on the sound of crackling flame and distant thunder, the Biblical, Indian and Anglo-Saxon names of hamlets and creeks and crossroads, for the most part unimportant in themselves until the day when the armies came together, as often by accident as on purpose, to give the scattered names a permanence and settle what manner of life future generations were to lead.  

Historian Shelby Foote, The Civil War: A Narrative

Related Content:

Watch World War I Unfold in a 6 Minute Time-Lapse Film: Every Day From 1914 to 1918

Watch World War II Rage Across Europe in a 7 Minute Time-Lapse Film: Every Day From 1939 to 1945

“The Civil War and Reconstruction,” a New MOOC by Pulitzer-Prize Winning Historian Eric Foner

Ayun Halliday is an author, illustrator, and Chief Primatologist of the East Village Inky zine. Her play, Fawnbook, opens in New York City later this fall. Follow her @AyunHalliday

Animated Map Lets You Watch the Unfolding of Every Day of the U.S. Civil War (1861-1865) is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

Electronics-Lab: PIC24 bedside table alarm clock


Markus Gritsch posted pictures and code of his PIC24 bedside table alarm clock:

Another year, another clock, but for the first time for my alarm clocks. I am not using an MSP430 but a PIC24 instead. Standby current is with 5.5 µA only slightly higher than that of my MSP430 based ones. Time keeping is done using the RTCC pheripheral, which I also used for the first time.
It can be seen in action in this YouTube video
Friendly green digits :)
And of course it has a LiFePO4 battery on its back, being charged every few years using my new USB charger.
A photo transistor is also included to dim the display in the dark. Much nices to the eyes when checking what time it is in the middle of the night.

PIC24 bedside table alarm clock – [Link]

The post PIC24 bedside table alarm clock appeared first on Electronics-Lab.

Penny Arcade: Comic: Le Livre Des Visages

New Comic: Le Livre Des Visages

Open Culture: The Periodic Table of Elements Scaled to Show The Elements’ Actual Abundance on Earth


When you learned about The Periodic Table of Elements in high school, it probably didn’t look like this. Above, we have a different way of visualizing the elements. Created by Professor William F. Sheehan at Santa Clara University in 1970, this chart takes the elements (usually shown like this) and scales them relative to their abundance on the Earth’s surface. In the small print beneath the chart, Sheehan notes “The chart emphasizes that in real life a chemist will probably meet O, Si, Al [Oxygen, Silicon and Aluminum] and that he better do something about it.” Click here to see the chart — and the less abundant elements — in a larger format. Below we have a few more creative takes on the Periodic Table.

Follow Open Culture on Facebook and Twitter and share intelligent media with your friends. Or better yet, sign up for our daily email and get a daily dose of Open Culture in your inbox.

via Pickover

Related Content:

“The Periodic Table Table” — All The Elements in Hand-Carved Wood

World’s Smallest Periodic Table on a Human Hair

“The Periodic Table of Storytelling” Reveals the Elements of Telling a Good Story

Chemistry on YouTube: “Periodic Table of Videos” Wins SPORE Prize

Free Online Chemistry Courses


The Periodic Table of Elements Scaled to Show The Elements’ Actual Abundance on Earth is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs. Comic for 2015.10.09

New Cyanide and Happiness Comic

Disquiet: Disquiet Junto Project 0197: Earliest Polyphony


Each Thursday in the Disquiet Junto group on and at, a new compositional challenge is set before the group’s members, who then have just over four days to upload a track in response to the assignment. Membership in the Junto is open: just join and participate.

This assignment was made in the early evening, California time, on Thursday, October 8, 2015, with a deadline of 11:59pm wherever you are on Monday, October 12, 2015.

These are the instructions that went out to the group’s email list (at

Disquiet Junto Project 0197: Earliest Polyphony
Sight-read newly uncovered choral music from the 10th century.

Thanks to Matthew Dean (, among others, for encouraging this project.

Step 1: Perhaps you’ve read the news about a newly uncovered piece of music, dating back to the 10th century, that is believed to be the earliest known piece of polyphonic music. You can check it out here:

Step 2: Review the notation in the article (and pictured on this project page on


Step 3: Record your own interpretation of the music. (You don’t have to sing it.)

Step 4: Then listen to and comment on tracks uploaded by your fellow Disquiet Junto participants.

Deadline: This assignment was made in the evening, California time, on Thursday, October 8, 2015, with a deadline of 11:59pm wherever you are on Monday, October 12, 2015.

Length: The length of your finished work should be as long as you see fit.

Upload: Please when posting your track on SoundCloud, only upload one track for this assignment, and be sure to include a description of your process in planning, composing, and recording it. This description is an essential element of the communicative process inherent in the Disquiet Junto. Photos, video, and lists of equipment are always appreciated.

Title/Tag: When adding your track to the Disquiet Junto group on, please include the term “disquiet0197-earlypolyphony” in the title of your track, and as a tag for your track.

Download: It is preferable that your track is set as downloadable, and that it allows for attributed remixing (i.e., a Creative Commons license permitting non-commercial sharing with attribution).

More on this 197th Disquiet Junto project (“Sight-read newly uncovered choral music from the 10th century”) at:

More on the Disquiet Junto at:

Join the Disquiet Junto at:

Disquiet Junto general discussion takes place at:

More on the source material for this project at:

IEEE Job Site RSS jobs: Department Chair, Electrical and Computer Engineering

Waterloo, Ontario, Canada University of Waterloo Thu, 08 Oct 2015 21:17:03 -0700

Disquiet: This Week in Sound: Bike Music + Ancient Acoustic Tiles +

A lightly annotated clipping service:

Bicycle Built for Tunes: We get the quarterly publication of the Historic New Orleans Collection as a reminder of our four years in New Orleans, from 1999 to 2003. The Fall 2015 issue lists recent acquisitions, among them some “bicycle sheet music.” A description by Robert Ticknor connects the rise of the bicycle in the latter half of the 1900s and the pre-radio era of popular music: “During this time, before the advent of radio, sheet music was a common means of bringing popular song into the American home. The recent acquisition of 18 pieces of bicycle-themed sheet music shows how the two trends merged for a short time around the turn of the century. With titles such as ‘The Pretty Little Scorcher’ and ‘The Crackajack March and Two Step,’ these songs often praised the healthful pleasures and independence of bicycle riding. The cyclist’s life, as depicted in ‘The Wheelman’s Song,’ is ‘one unfading spring /Green and blooming till its close.'” There’s a beautiful shot, as well, of “Cycle Polka.” You can read the full piece on page 20 of the freely downloadable PDF of the issue at


If These Halls Had Ears: Blogging platforms are paved with two- or three-post websites that start off with good intentions and then end so prematurely that it’s as if they barely ever began. But good intentions are reason enough to cue up, which promises a tour of great European concert halls as experienced from the perspective of a student of acoustics. The first stop takes us to the Amsterdam Concertgebouw, described as “essentially a big, minimally ornamented box.” The entry explores the unique characteristics of the hall — what makes it different from other, more recent box halls, as pictured above — and asks questions about its presumed superiority: “Should the acoustics privilege one type of music at the expense of others?” There also two prior entries, one a busker’s perspective on the subway as a performance venue, and another announcing the concert-hall tour. (Found via Christine Sun Kim.) The Tumblr appears to be the work of Willem Boning. The above illustration is from the blog entry, and was presumably drawn by its author. (Bonus fun fact: if you pop those line drawings of hall schematics into Google’s image search, you end up with lots of patterns for making clothes.) … I wrote that first section of this notice when I initially came upon the blog, and in the ensuing days there have been a bunch more posts, richly illustrated and observed, including “leather and feather” wall hangings as early acoustic panels, two very different organ scenarios in the Netherlands, and acoustical instruments at the Teylers Museum in Haarlem, including a “sound analyzer” from 1880 and a “sound mixer” from 1865.

She Came to the Land of Ice and Snow: At, intrepid and prolific artist Kate Carr reports on her field recording expedition in Iceland, complete with photography and audio. In a detailed summary of her journeying and procedures, she admirably de-romanticizes the landscape, and brings some humor to the grey of Ólafsfjörður: “One day after spending about half a day up in the silence near the top of one the nearby mountains recording the sounds of tiny pebbles tumbling from the peak, I began to notice the unmistakable throb of dance music. As I descended further it became a pounding soundtrack, which reverberated across the valley. It was the local aqua aerobics class, which takes place each day near the primary school.”

Startup Sound: There are many fronts in the entrepreneurial war to monetize artificial intelligence at the consumer level. So far as we presume that such intelligence will be recognizable to us, the presumed interface is not physical but aural — well, it’s physical to the extent that the aurality triggers something in our fairly sensitive human ears. Spike Jonze knew this in his fine movie Her, and Apple, Google, and Microsoft, among others, know it in their service-oriented fledgling technologies. For Apple, this intelligence is a humanoid known as Siri. Microsoft’s Cortana has a name that sounds like a font but is borrowed from a fictional artificial intelligence from a video game. (It says something about where we’re at that we must distinguish fictional artificial intelligence from non-fictional artificial intelligence.) Google continues to keep its AI behind a functional wall; it has no anthropomorphism-enticing name, just the willfully bland product appellation Google Now. Among the latest events in this AI war is Apple’s acquisition of a company called VocalIQ. It seems that VocalIQ focuses not on the response system, but the input system. For in AI, listening is just as important as thinking or speaking. Details at


Earliest Polyphony: As ever, the further we move forward in time, the more our technology advances, and thus the further back we can reach in time. This time it’s to what the Cambridge University describes as the “earliest known piece of polyphonic music” (see above). It dates back to the 10th century: “It is the earliest practical example of a piece of polyphonic music – the term given to music that combines more than one independent melody – ever discovered.” Now we can just hope for a Janet Cardiff installation to make it real for us. (Found via Jeff Kolar.)

This first appeared in the October 6, 2015, edition of the free Disquiet “This Week in Sound” email newsletter:

Ideas from CBC Radio (Highlights): Ideas at 50, Part 1

To help us celebrate this milestone anniversary, we invited those listeners to tell us about programs that inspired them to make major life changes, altered their world-views or simply piqued their intellectual curiosity.

Daniel Lemire's blog: Predicting the near future is a crazy, impossible game

Back in 1903, the Wright brothers flew for the first time, 20 feet above ground, for 12 seconds. Hardly anyone showed up. The event went vastly unnoticed. It was not reported in the press. The Wright brothers did not become famous until many years later. Yet, ten years later, in 1914, we had war planes used for reconnaissance and dropping (ineffective) bombs. It was not long before we had dogfighting above the battleground.

Lord Kelvin, one of the most reputed and respected scientist at the time, wrote in 1902 that “No balloon and no aeroplane will ever be practically successful.”

If we could not see ten years in the future, back in 1903, what makes us think that we can see ten or twenty years in the future in 2015?

Computer Science: Theory and Application: CompSci Weekend SuperThread (October 09, 2015)

/r/compsci strives to be the best online community for computer scientists. We moderate posts to keep things on topic.

This Weekend SuperThread provides a discussion area for posts that might be off-topic normally. Anything Goes: post your questions, ideas, requests for help, musings, or whatever comes to mind as comments in this thread.


  • If you're looking to answer questions, sort by new comments.
  • If you're looking for answers, sort by top comment.
  • Upvote a question you've answered for visibility.
  • Downvoting is discouraged. Save it for discourteous content only.


  • It's not truly "Anything Goes". Please follow Reddiquette and use common sense.
  • Homework help questions are discouraged.
submitted by AutoModerator
[link] [comment]

Quiet Earth: The Quietcast: Axelle Carolyn Talks TALES OF HALLOWEEN

[Editor's note: You can now subscribe to Quiet Earth's podcast on iTunes or via RSS!]

Axelle Carolyn lives and breathes horror movies. In fact, before she started making her own, she wrote a book on the subject titled "It Lives Again! Horror Movies in the New Millennium. Her husband is Neil Marshall, director of The Descent and Doomsday and she hangs out with some of the genre's brightest young Turks. So perhaps its no surprise that her brainchild, the new anthology film Tal [Continued ...]

new shelton wet/dry: ‘Il y a dans la jalousie plus d’amour-propre que d’amour.’ –La Rochefoucauld

A recent Norwegian study shows that men and women react differently to various types of infidelity. Whereas men are most jealous of sexual infidelity, so-called emotional infidelity is what makes women the most jealous. Evolutionary psychology may help explain why this may be. […] Men and women over thousands of generations have had to adapt [...]

Open Culture: 226 Ansel Adams Photographs of Great American National Parks Are Now Online

Adams Yellowstone

Like many American stories, the story of the National Parks begins with pillage, death, deep cultural misunderstanding, and venture capitalism. According to Ken Burns’ film series The National Parks: America’s Best Idea, we can date the idea back to 1851, with the “discovery” of Yosemite by a marauding armed battalion who entered the land “searching for Indians, intent on driving the natives from their homelands and onto reservations.” The Mariposa Battalion, led by Captain James D. Savage, set fire to the Indians’ homes and storehouses after they had retreated to the mountains, “in order to starve them into submission.” One member of the battalion, a doctor named Lafayette Bunnell, found himself entranced by the scenery amidst this destruction. “As I looked, a peculiar exalted sensation seemed to fill my whole being,” he wrote in his later accounts, “and I found myself in tears with emotion.” He named the place “Yosemite,” thinking it was the name of the Indian tribe the soldiers sought to force out or eradicate. The word, it turned out “meant something entirely different,” referring to people who should be feared: “It means, ‘they are killers.’”

Zion Adams

In 1855, a failed English gold prospector turned the place into a tourist attraction, and people flooded West to see it, prompting New York worthies like Horace Greeley and Frederick Law Olmsted to lobby for its federal protection. In 1864, Abraham Lincoln deeded Yosemite Valley and the Mariposa Grove, with its giant sequoias, to the state of California. Ever since then, National Parks have been threatened—if not by the occasional political candidate and his billionaire backers hoping to privatize the land, then by oil and gas drilling, and by fire, rising seas, or other effects of climate change. Though the U.S. emptied many of the parks of their inhabitants, it is ironically only the actions of the federal government that prevents the process begun by the Mariposa Battalion from reaching its conclusion in the total despoliation of these landscapes. It is these landscapes that have most come to symbolize the national character, whether as background in Frederic Remington’s paintings of the Indian Wars or in the photographs of Ansel Adams, who began and sustained his career in Yosemite Valley. “Yosemite National Park,” writes the National Park Service’s website,” was Adams’ chief inspiration.”

Grand Canyon Adams

Adams first became interested in visiting the National Park when he read In the Heart of the Sierras by James Hutchings—that failed English gold prospector. Thereafter, Adams photographed National Parks almost ritually, and in 1941, the National Park Service commissioned Adams to create a photo mural for the Department of the Interior Building in DC. The theme, the National Archives tells us, was to be “nature as exemplified and protected in the U.S. National Parks. The project was halted because of World War II and never resumed.” It must have felt like an especially sacred duty for Adams, who traveled the country photographing the Grand Canyon, Grand Teton, Kings Canyon, Mesa Verde, Rocky Mountain, Yellowstone, Yosemite, Carlsbad Caverns, Glacier, and Zion National Parks; Death Valley, Saguro, and Canyon de Chelly National Monuments,” and other locations like the Boulder (now Hoover) Dam and desert vistas in New Mexico.

Mesa Verde Adams

The photographs you see here are among the 226 taken by Adams for the project. They are now housed at the National Archives, and you can freely view them online or order prints at their site. At the top, we see a snow-covered tree from an apple orchard in Half Dome, Yosemite, where Adams had his first photographic “visualization” in 1927. Below it, the “Court of the Patriarchs” in Zion National Park, Utah. Further down, we have a breathtaking vision of the serpentine Grand Canyon, and just above, one of the few manmade structures, “Cliff Palace” at Mesa Verde National Park in Colorado. And here can you see a photograph of the Snake River in Grand Teton National Park.

adams grand teton

The mural project may have been abandoned, but Adams never stopped photographing the parks, nor advocating for their protection and, in fact, the protection of “the entire environment,” as he told a Playboy interviewer in 1983. “Only two and a half percent of the land in this country is protected,” said Adams then: “Not only are we being fought in trying to extend that two and a half percent to include other important or fragile areas but we are having to fight to protect that small two and a half percent. It is horrifying that we have to fight our own Government to save our environment.”

You can peruse the collection of Ansel Adams’ national park photos here.

Related Content:

Ansel Adams Reveals His Creative Process in 1958 Documentary

200 Ansel Adams Photographs Expose the Rigors of Life in Japanese Internment Camps During WW II

How to Take Photographs Like Ansel Adams: The Master Explains The Art of “Visualization”

Josh Jones is a writer and musician based in Durham, NC. Follow him at @jdmagness

226 Ansel Adams Photographs of Great American National Parks Are Now Online is a post from: Open Culture. Follow us on Facebook, Twitter, and Google Plus, or get our Daily Email. And don't miss our big collections of Free Online Courses, Free Online Movies, Free eBooksFree Audio Books, Free Foreign Language Lessons, and MOOCs.

CreativeApplications.Net: Clojure & Clojurescript – London workshops by Karsten Schmidt

8537639465_fe5275f634_oIf you're interested in interactive design and want a fast-track to start harnessing and mastering Clojure's innovative features, powerful abstractions, new tooling and concise syntax for web development, then these workshops below might be just the thing.

Colossal: Fluxos: A Mesmerizing Experimental Claymation Short by Diego Akel

When watching this short animation by Brazilian animator Diego Akel, you get the distinct feeling he covered a table with clay, turned on some music, and just started messing around while snapping a photo every minute or so, almost like a kid in a sandbox. You wouldn’t think abstract experimentation with clay would result in anything particularly compelling, but in this instance it happens to be amazing. Titled Fluxos, Akel says the piece is “an essay about the constant flows of life, a self-portrait of its own process, an improvise [sic] on Bach, an investigation on plasticine.”



Quiet Earth: New Trailer for PDK Adapt THE MAN IN THE HIGH CASTLE

The official first season of Amazon's The Man in the High Castle, based on Philip K. Dick's alternate history novel of the same name, premieres next week and a new trailer has dropped titled "Defiance". It uses a lot of footage from the season premier which Amazon used to gauge interest in the series a year or so ago, which makes sense as when the whole thing premiers many people will still be unfamiliar with the show. However, there is some new explosive footage near the end of the 2.35 minute run time.

The Man in the High Castle is produced by Ridley Scott and stars Rufus Sewell (John Adams, Dark City), Luke Kleintank (Pretty Little Liars) and Alexa Davalos (Mob City).

A glimpse into an alternate history of North America. What life after WWII ma [Continued ...]

Electronics-Lab: 3A Variable Bench PSU with Color Display



I am playing with electronics since i was a child and made numerous circuits.But still now,i didn’t made any power supply unit for general purpose use.So tired of making PSU for each circuit,I decided to make a stable Bench PSU for general purpose use with some enhanced features.I decided to made the core power supply analog controlled and extra features digitally controlled. So that’s why i choose LM350 linear regulator chip as the heart because 3A is sufficient for day to day use.

3A Variable Bench PSU with Color Display – [Link]

The post 3A Variable Bench PSU with Color Display appeared first on Electronics-Lab.

Colossal: Awesome Aquariums: Winners of the 2015 International Aquatic Plants Layout Contest

#1 (Grand Prize) Takayuki Fukada, Japan / Courtesy IAPLC & Aquabase

While most people are satisfied with giving their pet goldfish some colorful gravel, a plastic plant, and maybe one of those bubbly treasure chests, the entrants to the International Aquatic Plants Layout Contest (IAPLC) have turned aquarium design into an artform. The massive tanks require years of preparation and are focused almost entirely on the aesthetic presentation of plants using only natural elements.

The art of aquascaping is still a fledgling endeavor, first started in the 90s by Japanese wildlife photographer Takashi Amano. The annual IAPLC competition has grown dramatically since, with the 2015 contest seeing 2,545 entries from 69 countries. Japan, China, Brazil, and France dominate the top finalist spots (only 13 entries were from the United States). Finalists were announced in September.

The scoring of each aquarium is based on a complex matrix of six criteria: the recreation of natural habitat for fish; the creator’s technical skills; the long-term maintenance of the habitat; the originality and impression of the layout; presentation of natural layout; and the overall composition and planting ‘balance’. Participants face severe penalties for reconfiguring elements from their own past entries, stealing ideas from others, and using plants that may not last long-term in the environment presented.

This year’s grand prize winner was Takayuki Fukada from Japan with his aquarium titled Longing. You can see our previous coverage of the IAPLC here. All images courtesy IAPLC and AquaA3. (via Vice)

#2 范博文, China / Courtesy IAPLC & AquaA3

#4 Paulo Pacheco, Brazil / Courtesy IAPLC & Aquabase

#5 叶毅, China / Courtesy IAPLC & Aquabase

#7 刘勇, China / Courtesy IAPLC & Aquabase

#8 タナカカツキ, Japan / Courtesy IAPLC & Aquabase

#10 Luis Carlos Galarraga, Brazil / Courtesy IAPLC & Aquabase

#12 Ana Paula Cinato, Brazil / Courtesy IAPLC & Aquabase

#16 张大东, China / Courtesy IAPLC & Aquabase

#19 薛海, Taiwan / Courtesy IAPLC & Aquabase

#21 Andre Longarco, Brazil / Courtesy IAPLC & Aquabase

#22 Olivier Thebaud, France / Courtesy IAPLC & Aquabase

#23 Michaël Leroy, France / Courtesy IAPLC & Aquabase

Quiet Earth: Luc Besson Talks VALERIAN, Launches Design Contest [Video]

A couple things of note here. Luc Besson's most ambitious project to date is official happening. The $180 million film, Valerian and the City of A Thousand Planets, recently cast Clive Owen in the lead and is based on a French comic series from writers Pierre Christin and Jean-Claude Mézières that first appeared in 1967. Owen will play a character called "Commander Arün Filitt".

The first title treatment for the film has dropped along with word that Besson and costume designer Olivier Bériot are asking for designers, artists, and creatives the world over to help dress twenty of the party guests.

The creative team wants to see your designs, which [Continued ...]

The Rhizome Frontpage RSS: Organic Hardware at Fantastic Arcade

 Paloma Dawkins and Cale Bradbury, Alea (customized arcade cabinet and moss controllers at Fantastic Arcade, 2015)

This past week, Fantastic Arcade, an independently curated video games arcade featuring talks, tournaments, and over 45 playable games—part of the Fantastic Fest film festival—was held in Austin's Alamo Drafthouse.

A number of the games at Fantastic Arcade this year featured alternative game controllers. Cat Nips contains stuffed animals whose bellies need to be rubbed; the gameplay in Butt Sniffin' Pugs was controlled by balls that needed to be rolled. Other games used a receipt dispenser and a gun with which one played Russian Roulette. A fair amount of the games, easily accessible in the arcade setup, featured used standard controllers and interfaces, from Playstation controllers to mice and keyboards. The audience was diverse; the only underrepresented group appeared to be X-box players (fun fact: Sony Playstation sponsored Fantastic Arcade).

Perhaps the most innovative and interesting game was Alea, a psychedelic hiking simulator designed by Paloma Dawkins and Cale Bradbury using organic materials as part of the hardware. Alea's gameplay centers on the tension of playing with controllers that are actively deteriorating before the player's eyes. The creators placed real moss over the flex sensors, which began to degrade and die through use as the installation went on. According to Cale Bradbury, the controllers were inspired by William S. Burroughs' Naked Lunch "where [the character] became one with his typewriter" and described the destruction of the moss as "mirroring how people treat nature." Paloma Dawkins remarked that "tech and nature just don’t really go together. Right now, the controllers are getting destroyed and people are frustrated because it’s just so different." The gameplay replicates a particular hiking experience of Dawkins’ while shedding light on the tense and often antagonistic relationship between technological modernity and nature. I was struck by the juxtaposition of a soft plant surface and the technology with which it was integrated, and by the fact that the man-made controller was gradually revealed as the moss degraded through play. Fantastic Arcade's games begged to be touched, hit, smacked, and explored; but the beauty of Alea was that the more it was played, the more the controllers that facilitate play fell apart. The game anticipated—even invited—its own destruction.

Paloma Dawkins and Cale Bradbury, Alea (2015)

As a game, Alea features different levels of colorful, '70s-styleforest, with branches that move according to the rhythm of the player touching the moss controllers. The pace is set by laidback rock and electronica music in the background. Alea was inspired by both Bradbury's interest in net art and a particular trip Dawkins took to the Muir Redwoods Forest. Dawkins, an illustrator and videogame designer, conceived of the game after reflecting on the difference between her and her companions' behavior while hiking: while they moved quickly through the woods, Dawkins fell behind, distracted by the beauty of the trees. "I was trying to keep up… [but] it was such a weird sensation of trying to not fall …and trying to have a connection to where you are," she said.

The rhythm of the gameplay reflects the tension Dawkins experienced on her hike: wanting to take in the surrounding beauty while trying to keep pace all the beats and animations are deliberately programmed pattern loops that repeat over and over, providing a meditative experience for the player.

Of the games I tried at Arcade, Alea did the most to push the boundaries of thematic concepts within gaming. It felt refreshingly earnest and thoughtful, and I hope to see more games that blur the lines between interactive art and gameplay—a rich and under-explored territory within the indie games scene. Alea is a rewarding step in that direction.


Alea co-designer Paloma Dawkins playing the game

Saturday Morning Breakfast Cereal: Saturday Morning Breakfast Cereal - Kids

Hovertext: No more syntax for you. Only precious gurgling noises.

New comic!
Today's News:

You're coming to see me and The Oatmeal and Abby Howard this weekend, right?!


explodingdog: moma: Learn about artist Ryan McGinness’s printmaking...


Learn about artist Ryan McGinness’s printmaking process

[Artist Ryan McGinness and Lower East Side Printshop artistic director/master printer Erik Houge hold up a print at a MoMA Junior Associates event in October 2015. Photo by Jessica Womack]

Paper Bits: Executive Dysfunction




So this was originally a comment on a post about depression and so forth, but it actually occurred to me that it might be more helpful in a tag somewhere where someone might see it, rather than buried in 68k notes.  So here’s the thing: I’m not great at explaining what executive functioning problems ARE, but I tried to explain what they feel like.

Looking at a dirty litterbox and a sink full of dishes and going “fuck this noise” and going back on tumblr feels a lot like laziness, even if you are feeling kind of like crying just looking at them. But it can also be your brain being currently incapable of putting together the steps you need to take in order to DO those things, you can’t quite put together that cleaning the litterbox is:

  1. Get a trash bag
  2. Get the litter scoop
  3. Get clean litter
  4. Open trash bag
  5. Move litterbox to accessible position
  6. Crouch down by the litterbox
  7. Scoop out poop and clumps
  8. Tie off trash bag
  9. Add some clean litter to box
  10. Put litterbox back in its original position
  11. Put litter scoop away
  12. Put clean litter away
  13. Throw away trash bag

When you’re having executive functioning issues, you look at the dirty litterbox and even if you don’t realize it, you can’t work out those steps, you just see the dirty litterbox and know that it needs to be clean and all those steps are mushing together into one big ball of overwhelming stress and you can’t quite figure out where to start, and it takes a LOT of mental and emotional momentum to start, and when you’re depressed or overwhelmed or whatever it can be next to impossible to GET that mental and emotional momentum.

This isn’t the best explanation of executive dysfunction, probably, but it’s the best I’ve got, and it can be awful, and it can make you feel like a lazy useless person when you’re nothing of the sort, and it’s so insidious, because when you’re NOT having these issues it’s the easiest thing in the world to subconsciously put all those steps together and get from “dirty litterbox” to “clean litterbox” without any conscious thought.

This can happen when you’re depressed, if you have ADHD or autism, if you have anxiety… there are a lot of reasons you might run into problems with your executive functioning.  It can be simple things like cleaning the litterbox, it can be things you do (or try to do) regularly like your math homework, it can be something like going to the gym or cooking dinner or getting out of bed in the morning.

But the most important thing to take away from this is that there is a huge difference between “I could do this but I really don’t want to” and “I cannot do this”, and when you learn to recognize the difference, you can begin to stop calling yourself “lazy” and “useless” and “worthless” during those times when you CAN’T do this even if you want to.  

Yeah, autistic people, people with depression, or ADHD, or anxiety… we can all be lazy sometimes.  And that’s okay, it’s normal to be lazy sometimes.  And we can still have issues with laziness.  But the difference is real, and important, and I feel like not enough people outside of the autistic and maybe ADHD communities realize that this is something that they might be struggling with.  

I just learned about this today and it’s something I’ve struggled with MY. ENTIRE. LIFE. And I’m in my late 30’s. That moment you’re talking about, where all the steps mush together? That’s my daily life with everything from laundry to my career. Lately it’s been worse because of depression on top of my adhd. Just started medication but executive functioning hasn’t really improved. I have an appointment tomorrow tho. Well, in 11 hours. I should be sleeping but I’m scrolling through tumblr. Hyperfocused on “executive dysfunction.” Erm…yeah.

Learning about executive dysfunction was the turning point for me in learning to deal with ADHD.  The ability to read the way my brain works without judgment, simply as the way it is, is what finally moved me to be able to actually change things.  

My first doctor handed me a prescription and sent me on my way.  I now see that as malpractice.  I eventually found a psychiatrist who taught me about executive function skills and pointed me to the resources I needed to reimagine myself and begin to create in myself a person I wasn’t constantly disappointed in and judging.

explodingdog: Photo

Electronics-Lab: Electronic Live Capture Mousetrap

A mousetrap is a type of animal trap specialize to catch small animals, particularly rodents like rats, mice, hamsters, etc. This project is a kind of mousetrap that is intended to keep a captured animal alive. In this way, the hunter can release the captured animal later to the wild.

The PIC12F683 microcontroller acts as the heart of the project; it is programmed to meet function of the design. The sensor used in this project is a pair of infrared transmitter and receiver. An infrared LED connected to the GP2 pin of the PIC12F683 transmits continuous infrared signal to the TSOP1138 infrared receiver connected to the GP1 pin of the PIC12F683. To avoid the effect of ambient light, the generated signal at GP2 pin to the infrared LED is modulated at 38kHz frequency. Once the infrared beam is broken, the GP1 input changes, thus, the PIC12F683 reacts by triggering the GP4 pin connected to the BS170 MOSFET that act as a switch of the relay. The relay switch is set to shut the door when triggered. A push button connected at GP3 pin of the PIC12F683 is used for reset.

This project has a simple concept; the trap is built on a box fitted for a rodent to enter. The bait is placed inside the box to lure the rodent in. A sensor will be triggered once the rodent is inside the box, then a single door will shut lock behind the captured rodent.

Electronic Live Capture Mousetrap – [Link]

The post Electronic Live Capture Mousetrap appeared first on Electronics-Lab.

Disquiet: Everything Passes with Ease

Matthew Barlow’s “Sound Meditation 3” is eight minutes of gently pulsing tones. They layer and they ripple. The ripples spread out as new tones emerge. Somehow the fragility is retained, despite the sequential activity, despite the accumulation of tones, the eternal reemergence of tones. The piece never comes close to suggesting, let alone reaching, anything like a critical mass. Everything passes with ease. Balancing the elegance is an underlying plasticity to the tones. It is light music made from vaguely unnatural sounds, a synthesizer’s vision of cloud formations, a silicon chip’s sense of water drops.

Track originally posted at More from Barlow, who is based in Asheville, North Carolina, at

Planet Haskell: Gabriel Gonzalez: Basic Haskell Examples

The Haskell community self-selects for people interested in unique things that Haskell can do that other languages cannot do. Consequently, a large chunk of Haskell example code in the wild uses advanced idioms (and I'm guilty of that, too).

So I would like to swing the pendulum in the other direction by just writing five small but useful programs without any imports, language extensions, or advanced features. These are programs that you could write in any other language and that's the point: you can use Haskell in the same way that you use other languages.

They won't be the prettiest or most type-safe programs, but that's okay.

Example #1: TODO program

This program is an interactive TODO list:

putTodo :: (Int, String) -> IO ()
putTodo (n, todo) = putStrLn (show n ++ ": " ++ todo)

prompt :: [String] -> IO ()
prompt todos = do
putStrLn ""
putStrLn "Current TODO list:"
mapM_ putTodo (zip [0..] todos)
command <- getLine
interpret command todos

interpret :: String -> [String] -> IO ()
interpret ('+':' ':todo) todos = prompt (todo:todos)
interpret ('-':' ':num ) todos =
case delete (read num) todos of
Nothing -> do
putStrLn "No TODO entry matches the given number"
prompt todos
Just todos' -> prompt todos'
interpret "q" todos = return ()
interpret command todos = do
putStrLn ("Invalid command: `" ++ command ++ "`")
prompt todos

delete :: Int -> [a] -> Maybe [a]
delete 0 (_:as) = Just as
delete n (a:as) = do
let n' = n - 1
as' <- n' `seq` delete n' as
return (a:as')
delete _ [] = Nothing

main = do
putStrLn "Commands:"
putStrLn "+ <String> - Add a TODO entry"
putStrLn "- <Int> - Delete the numbered entry"
putStrLn "q - Quit"
prompt []

Example usage:

$ runghc todo.hs
+ <String> - Add a TODO entry
- <Int> - Delete the numbered entry
q - Quit

Current TODO list:
+ Go to bed

Current TODO list:
0: Go to bed
+ Buy some milk

Current TODO list:
0: Buy some milk
1: Go to bed
+ Shampoo the hamster

Current TODO list:
0: Shampoo the hamster
1: Buy some milk
2: Go to bed
- 1

Current TODO list:
0: Shampoo the hamster
1: Go to bed

Example #2 - Rudimentary TSV to CSV

The following program transforms tab-separated standard input into comma-separated standard output:

splitOn :: Char -> String -> [String]
splitOn c' str = loop "" str
loop :: String -> String -> [String]
loop accum [] = [reverse accum]
loop accum (c:cs) | c == c' = reverse accum : loop "" cs
| otherwise = loop (c:accum) cs

joinWith :: Char -> [String] -> String
joinWith _ [] = ""
joinWith _ [str] = str
joinWith c (str:strs) = str ++ [c] ++ joinWith c strs

main = do
str <- getContents

let linesIn :: [String]
linesIn = lines str

let linesOut :: [String]
linesOut = map (joinWith ',' . splitOn '\t') linesIn

putStr (unlines linesOut)

Example usage:

$ cat file.tsv
1 2 3
4 5 6
$ cat file.tsv | runghc tsv2csv.hs

Example #3 - Calendar

This program prints a calendar for 2015

data DayOfWeek
= Sunday | Monday | Tuesday | Wednesday | Thursday | Friday | Saturday
deriving (Eq, Enum, Bounded)

data Month
= January | February | March | April | May | June
| July | August | September | October | November | December
deriving (Enum, Bounded, Show)

next :: (Eq a, Enum a, Bounded a) => a -> a
next x | x == maxBound = minBound
| otherwise = succ x

pad :: Int -> String
pad day = case show day of
[c] -> [' ', c]
cs -> cs

month :: Month -> DayOfWeek -> Int -> String
month m startDay maxDay = show m ++ " 2015\n" ++ week ++ spaces Sunday
week = "Su Mo Tu We Th Fr Sa\n"

spaces currDay | startDay == currDay = days startDay 1
| otherwise = " " ++ spaces (next currDay)

days Sunday n | n > maxDay = "\n"
days _ n | n > maxDay = "\n\n"
days Saturday n = pad n ++ "\n" ++ days Sunday (succ n)
days day n = pad n ++ " " ++ days (next day) (succ n)

year = month January Thursday 31
++ month February Sunday 28
++ month March Sunday 31
++ month April Wednesday 30
++ month May Friday 31
++ month June Monday 30
++ month July Wednesday 31
++ month August Saturday 31
++ month September Tuesday 30
++ month October Thursday 31
++ month November Sunday 30
++ month December Tuesday 31

main = putStr year

Example usage:

$ runghc calendar.hs
January 2015
Su Mo Tu We Th Fr Sa
1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31

February 2015
Su Mo Tu We Th Fr Sa
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28

March 2015
Su Mo Tu We Th Fr Sa
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30 31

April 2015
Su Mo Tu We Th Fr Sa
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30

May 2015
Su Mo Tu We Th Fr Sa
1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30

June 2015
Su Mo Tu We Th Fr Sa
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30

July 2015
Su Mo Tu We Th Fr Sa
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31

August 2015
Su Mo Tu We Th Fr Sa
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30 31

September 2015
Su Mo Tu We Th Fr Sa
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30

October 2015
Su Mo Tu We Th Fr Sa
1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31

November 2015
Su Mo Tu We Th Fr Sa
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30

December 2015
Su Mo Tu We Th Fr Sa
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31

Example #4 - Decode RNA

This program converts an RNA sequence read from standard input into the equivalent sequence of amino acids written to standard output, using the genetic code:

data RNA = A | U | C | G
deriving (Read)

data AminoAcid
= Ala | Cys | Asp | Glu | Phe | Gly | His | Ile | Lys | Leu
| Met | Asn | Pro | Gln | Arg | Ser | Thr | Val | Trp | Tyr
| Stop
deriving (Show)

decode :: RNA -> RNA -> RNA -> AminoAcid
decode U U U = Phe
decode U U C = Phe
decode U U A = Leu
decode U U G = Leu
decode U C _ = Ser
decode U A U = Tyr
decode U A C = Tyr
decode U A A = Stop
decode U A G = Stop
decode U G U = Cys
decode U G C = Cys
decode U G A = Stop
decode U G G = Trp
decode C U _ = Leu
decode C C _ = Pro
decode C A U = His
decode C A C = His
decode C A A = Gln
decode C A G = Gln
decode C G _ = Arg
decode A U U = Ile
decode A U C = Ile
decode A U A = Ile
decode A U G = Met
decode A C _ = Thr
decode A A U = Asn
decode A A C = Asn
decode A A A = Lys
decode A A G = Lys
decode A G U = Ser
decode A G C = Ser
decode A G A = Arg
decode A G G = Arg
decode G U _ = Val
decode G C _ = Ala
decode G A U = Asp
decode G A C = Asp
decode G A A = Glu
decode G A G = Glu
decode G G _ = Gly

decodeAll :: [RNA] -> [AminoAcid]
decodeAll (a:b:c:ds) = decode a b c : decodeAll ds
decodeAll _ = []

main = do
str <- getContents
let rna :: [RNA]
rna = map (\c -> read [c]) str

let aminoAcids :: [AminoAcid]
aminoAcids = decodeAll rna

putStrLn (concatMap show aminoAcids)

Example usage:

$ echo "ACAUGUCAGUACGUAGCUAC" | runghc decode.hs

Example #5 - Bedtime story generator

This generates a "random" bedtime story:

stories :: [String]
stories = do
let str0 = "There once was "

str1 <- ["a princess ", "a cat ", "a little boy "]

let str2 = "who lived in "

str3 <- ["a shoe.", "a castle.", "an enchanted forest."]

let str4 = " They found a "

str5 <- ["giant ", "frog ", "treasure chest " ]

let str6 = "while "

str7 <- ["when they got lost ", "while strolling along "]

let str8 = "and immediately regretted it. Then a "

str9 <- ["lumberjack ", "wolf ", "magical pony "]

let str10 = "named "

str11 <- ["Pinkie Pie ", "Little John ", "Boris "]

let str12 = "found them and "

str13 <- ["saved the day.", "granted them three wishes."]

let str14 = " The end."

return ( str0
++ str1
++ str2
++ str3
++ str4
++ str5
++ str6
++ str7
++ str8
++ str9
++ str10
++ str11
++ str12
++ str13
++ str14

main = do
let len = length stories
putStrLn ("Enter a number from 0 to " ++ show (len - 1))
n <- readLn
putStrLn ""
putStrLn (stories !! n)

Example usage:

$ runghc story.hs
Enter a number from 0 to 971

There once was a princess who lived in an enchanted forest. They found a giant
while while strolling along and immediately regretted it. Then a lumberjack
named Boris found them and saved the day. The end.


If you would like to contribute a simple example of your own, try sharing a paste of your program under the #Haskell #BackToBasics hashtags. Comic for 2015.10.08

New Cyanide and Happiness Comic

Ideas from CBC Radio (Highlights): Brother West (Encore June 2, 2015)

Author, provocative intellectual and self-described 'jazz man of ideas', Cornel West talks about righteous anger and the fight for social justice, the lack of integrity in American political office, and his passion for John Coltrane.

Penny Arcade: News Post: Club PA Comic Preview

Tycho: The full strip and its accompanying postito go out later this month to members, and becoming a member is incredibly easy and is also rad for too many reasons to enumerate here, which is why there’s a whole page dedicated to it.  I think this one is pretty Goddamn good:   (CW)TB

Instructables: exploring - featured: Pumpkin Pie Spice Macarons

If you cannot find pumpkin pie spice, check out the next step to make your own! Ingredients and Method I know French Macarons are almond cookies, but these macarons is using almond and walnut! But of course you can use whole almond or whole walnut instead half and half as I do, walnut is much mor...
By: klinong

Continue Reading »

Paper Bits: "In a world where everything is tracked and kept forever, like the world we’re for some reason..."

“In a world where everything is tracked and kept forever, like the world we’re for some reason building, you become hostage to the worst thing you’ve ever done.”

- Haunted By Data

explodingdog: Photo

Jesse Moynihan: Process Pic 7

Here’s the original sketch design for Ahura Mazda’s breast canon piss tank. Why do I have piss coming out of breast shaped canons? I guess I think it’s funny, and it speaks to Ahura Mazda’s confused and abusive state of Tamas. I was looking at Metal Slug designs and Akira Toriyama vehicle designs to get […]

explodingdog: Photo

Colossal: Sprawling Tattoo-Inspired Ink Drawings by ‘Benze’

Stop Whispering

Stop Whispering

Stop Whispering

Stop Whispering

Hungarian artist Benze produces intensely detailed ink drawings by fusing aspects of tattoo art and objects from the natural world, components the artist views as an important way to continuously open his work to new meanings and interpretations. The excruciating detail achieved through stippling and cross hatching with fine pens is stunning whether viewed in its entirety or zoomed in on various sections—simultaneously existing on a macro and micro level.

“Each work has its own gravitational field which irresistibly forces us to zoom in, explore more, discover new aspects within the whole,” says Benze.

The content of his drawings typically involves female faces with ornate head pieces adorning the women’s hair. Natural elements make up these decorative pieces, including objects like flowers, grasses, twigs and posed animal skeletons.

You can see more work from the artist on his Behance page here. (via Scene360)

Stop Whispering

Stop Whispering

Stop Whispering

Stop Whispering







explodingdog-pictures: "I hate this machine"

I hate this machine

Paper Bits: "You Won’t Believe How This One OkCupid Message A Guy Received In April Of 2013 Proves That..."

“You Won’t Believe How This One OkCupid Message A Guy Received In April Of 2013 Proves That Feminism Is A Conspiracy.‘”

- If things said to female writers were clickbait headlines

Quiet Earth: FEAR THE WALKING DEAD Hits Blu-ray & DVD Dec. 1

With season six of The Walking Dead premiering this Sunday, Anchor Bay Entertainment has announced they will release Fear the Walking Dead: The Complete First Season on Blu-ray and DVD on December 1st.

Created by Robert Kirkman the guys behind the mega hit series The Walking Dead and Dave Erickson (“Sons of Anarchy”), the series premiered in August as the #1 show in cable history. Not too shabby. While critical opinion was mixed, it was still a huge hit for the new network.

Before you buy though, Anchor Bay have confirmed that a Special Edition release will come in 2016.

From the release:
Living in the same universe as “The Walking Dead”, “Fear the Walking Dead” is a gritty drama that explores the [Continued ...]

bit-player: The writing on the wall

South wall. Hover to magnify.

Carvings in upper portion of the south wall of moat tunnel at Terezin

A place where thousands of people suffered and died makes an uncomfortable tourist destination, yet looking away from the horror seems even worse than staring. And so, when Ros and I were driving from Prague to Dresden last month, we took a slight detour to visit Terezín, the Czech site that was the Theresienstadt concentration camp from late 1941 to mid 1945. We expected to be disturbed, but we stumbled onto something that was disturbing in an unexpected way.

Terezín was not built as a Nazi concentration camp. It began as a fortress, erected in the 1790s to defend the Austrian empire from Prussian threats. Earthen ramparts and bastions surround buildings that were originally the barracks and stables for a garrison of a few thousand troops. By the 20th century the fortress no longer served any military purpose. The troops withdrew, civilians moved in, and the place became a town with a population of about 7,000.

In 1941 the Gestapo and the SS siezed Terezín, expelled the Czech residents, and began the “resettlement” of Jews deported from Prague and elsewhere. In the next three years 150,000 prisoners passed through the camp. All but 18,000 perished before the end of the war.

Now Terezín is again a Czech town, as well as a museum and memorial to the holocaust victims. It seems a lonely place. A few boys kick a ball around on the old parade ground, the café has two or three customers, someone is holding a rummage sale—but the town’s population and economy have not recovered. The museum occupies parts of a dozen buildings, but many of the others appear to be vacant.

We looked at the museum exhibits, then wandered off the route of the self-guided tour. At the edge of town, near a construction site, a tunnel passed under the fortifications. Walking through, we came out into a grassy strip of land between the inner and outer ramparts. When we turned back to the tunnel, we noticed graffiti on the walls of the portal.

At first I assumed it was recent adolescent scribbling, but on looking closer we began to see dates in the 1940s, carved into the sandstone blocks. Could it be true? Could these incised names and drawings really be messages from the concentration-camp era? If so, who left them for us? Did the prisoners have access to this tunnel, or was it an SS guard post?

North wall.

Carvings in upper portion of the north wall of moat tunnel at Terezin

I was skeptical. Too good to be true, I thought. If the carvings were genuine, they would not have been left out here, exposed to the elements and unprotected against vandalism. They would be behind glass in one of the museum galleries. But if they were not genuine, what were they?

I took pictures. (The originals are on Flickr.)

Back home, some days later, my questions were answered. Googling for a few phrases I could read in the inscriptions turned up the website, which offers extensive documentation and interpretation (in Česky, Deutsch, and English). Briefly, the carvings are indeed authentic, as shown by photographs made in 1945 soon after the camp was liberated. The markings were made by members of the Ghettowache, the internal police force selected from the prison population. A dozen of the artists have been identified by name.

The website is the project of Uta Fischer, a city planner in Berlin, with the photographer Roland Wildberg and other German and Czech collaborators. They are working to preserve the carvings and several other artifacts discovered in Terezín in the past few years.

I offer a few notes and speculations on some of the inscriptions, drawing heavily on Fischer’s commentary and translations:

Inscription: Brána strežena stráží ghetta “Brána střežena stráží ghetta L.P. 1944.” Translation from “The gate is being guarded by the ghetto guard, A.D. 1944.” This sign, given a prominent position at the entrance to the tunnel, reads like a territorial declaration. The date is interesting. Are we to infer that the gate was not guarded by the stráží ghetta before 1944?
Inscription: In remembrance of the stay 1941–1944 “Pamatce na pobyt 1941–1944.” Translation from “In remembrance of the stay 1941–1944.” Fischer remarks on the formality of the inscription, suggesting that this part of the south wall was created as “a collective place of remembrance.” The carving has been badly damaged since the first photos were made in 1945.
carving of a floral arrangement 4989 A floral arrangement is the most elaborate of all the carvings. Fischer identifies the artist as Karel Russ, a shopkeeper in the Bohemian town of Kyšperk (now Letohrad). Fischer writes: “In the top center there is still a recognizable outline of the Star of David that was already removed in a rough manner in 1945.” For what it’s worth, I’m not so sure that’s not another flower. The deep hole in the middle was not present in 1945 and is not explained.
Caricature captioned "Il capitano della guardia" Four caricatures of the same figure are lined up on a single sandstone block on the north wall, with a fifth squeezed into a narrow spot on the block below. Why the repetition? And who was the subject? The Italian legend “Il capitano della guardia” and the double stripe on the hat suggest a high-ranking Ghettowache official. Did he take these cartoonish portrayals with good humor? Or could the drawings possibly be selfies?
Menorah and palm tree The menorah at the bottom left of this panel is the only explicitly Jewish iconography I have spotted in these images. (As noted above, Fischer believes the floral panel included a Star of David.) As far as I can tell, there are no Hebrew inscriptions.
Man and woman? By 'M.C. 1944' Portraits of a man and a woman? That’s my best guess, but the carving is indistinct. The line above presumably reads “M.C. 1944,” but the “1″ has been gouged away.
1911 inscription by Alchus Jan Not all of the inscriptions come from the Second World War. This one, signed “Alchuz Jan,” is dated August 6, 1911. Another (not shown) claims to be from 1871.
Postwar graffiti: lovers in 1953, a recent scrawl It’s only to be expected that there are also later additions to the graffiti. Toward the bottom of this panel we have B.K. ♥ R.V. 1953. The white scrawl at top left is much more recent. On the other hand, the signature of “Waltuch Wilhelm” at upper right is from the war years. Fischer has identified him as the owner of a cinema in Vienna. Elsewhere he also signed his name in Cyrillic script.

I am curious about the chronology of the Ghettowache inscriptions. Are we seeing an accumulation of work carried out over a period of years, or was all the carving done in a few weeks or months? The preponderance of items dated 1944 argues for the latter view. In particular, the inscription “In remembrance of the stay 1941–1944” could not have been written before 1944, and it suggests some foreknowledge that the stay would soon be over.

A lot was going on at Terezín in 1944. In June, the camp was cleaned up for a stage-managed, sham inspection by the Red Cross; to reduce overcrowding in preparation for this event, part of the population was deported to Auschwitz. Later that summer, the SS produced a propaganda film portraying Theresienstadt as a pleasant retreat and retirement village for Jewish families; the film wasn’t really titled “The Führer Gives a Village to the Jews,” but it might as well have been. As soon as the filming was done, thousands more of the residents were sent to the death camps, including most of those who had acted in the movie. In the fall, with the war going badly for Germany, the SS decided to close the camp and transport everyone to the East. Perhaps that is when some of the inscriptions with a tone of finality were carved—but I’m only guessing about this.

As it happens, the liquidation of the ghetto was never completed, and in the spring of 1945 the flow of prisoners was reversed. Trains brought survivors back from the extermination camps in Poland, which were about to be overrun by the Red Army. When Terezín was liberated by the Soviets in early May, there were several thousand inmates. But the tunnel has no inscriptions dated 1945.

Graffiti is a varied genre. It encompasses scatological scribbling in the toilet stall, romantic declarations carved on tree trunks, the existential yawps of spray-paint taggers, dissident political slogans on city walls, religious ranting, sports fanaticism, and much else. It’s often provocative, sometimes indecent, imflammatory, insulting, or funny. The tunnel carvings at Terezín evoke a quite different set of adjectives: poignant, elegiac, calm, tender. It’s not surprising that we see no overtly political or accusatory statements—no strident “Let my people go,” no outing of torturers or collaborators. After all, these messages were written under the noses of a Nazi administration that wielded absolute and arbitrary power of life and death. Even so—even considering the circumstances—there’s an extraordinary emotional restraint on exhibit here.

What audience were the tunnel elegists addressing? I have to believe it was us, an unknown posterity who might wander by in some unimaginable future.

When Ros and I wandered by, the fact that we had discovered the place by pure chance, as if it were a treasure newly unearthed, made the experience all the more moving. Seeing the stones in a museum exhibit—curated, annotated, preserved—would have had less impact. Nevertheless, that is unquestionably where they belong. Uta Fischer and her colleagues are working to make that happen. I hope they succeed in time.

Penny Arcade: News Post: Vox Something Or Other

Tycho: Motherboard merely joins a raft of sites which have, over the last couple years, removed the ability for users to comment on their articles.  It’s funny; the first thing I did was scroll to the bottom of the page to see what people thought about it.  There was no comment section there, which I probably should have guessed.  Force of habit. Comments are what they are.  “Don’t read the comments” is a phrase you have heard, and perhaps used.  Sometimes people say that it’s not enough to say “don’t read the comments” and…


Here's the first page of my new comic book
ANDREW BRENDAN: King of the Internet #1! 
If you like it, check out the 28 page first issue available NOW in the OVC store!

explodingdog: I hate this machinenew at

I hate this machine

new at

Saturday Morning Breakfast Cereal: Saturday Morning Breakfast Cereal - A Recording

Hovertext: Kelly felt this one was too mean. I, on the other hand, feel nothing.

New comic!
Today's News:

The Rhizome Frontpage RSS: Mapping Landscape Paintings: Joe Hamilton's 'Indirect Flights' on the front page

Joe Hamilton's Indirect Flights is on the front page of through Sunday, as part of the ongoing online digital painting exhibition "Brushes," presented by Rhizome and the New Museum as part of the First Look series.

All of the works in "Brushes" are paintings made on the computer and shown primarily online. The exhibition focuses on works that are derived from an artist's bodily gestures, rather than those that are derived from code-based practices. In the case of Indirect Flights, the brushstrokes in the work are actually sampled from high-resolution scans of landscape paintings by notable historical figures like Van Gogh and Arthur Streeton. Thus, the gestures in this case were made long ago on canvas, and only later translated to digital form. 

Hamilton writes,

The brushstrokes are included in a panoramic collage that also includes satellite images, organic textures, and architectural fragments, which can be navigated via a a Google Maps-like interface. I was drawn to the use of found aerial photography as a base for the work and then contrasting it in the foreground with my own close up photographs of raw materials and architecture. A mixture of micro and macro, found and recorded, personal and impersonal.

The work includes sound by J.G. Biberkopf; it was supported by The Moving Museum. A past interview with Hamilton about the work can be read here.


Michael Geist: CBC Shoots Itself in the Foot With Election Debate Coverage

Hubert Lacroix, the president of the CBC, recently placed the future of the Canada’s national public broadcaster on the electoral map with comments aimed sparking a renewed debate on future funding models. Lacroix disputed claims that low ratings are to blame for the CBC’s financial struggles, instead pointing to the need to consider alternative fee schemes, including new levies on Internet providers or supplementary charges on television purchases.

While disagreement over CBC funding is as old as the broadcaster itself, the more uncomfortable discussion for the CBC is its coverage of the current election campaign – particularly its approach to national debates and political party advertising – which raises troubling questions about its relevance in the current media environment.

My weekly technology law column (Toronto Star version, homepage version) suggests that most would agree that the CBC features an excellent group of reporters and boasts insightful analysts for its panel discussions. However, rather than working to make itself an invaluable resource for the election, the CBC has been unnecessarily restrictive in its broadcasting choices and in the use of its content.

The most puzzling decision has been its refusal to broadcast debates hosted by other organizations. The CBC may be disappointed with the debate approach adopted by the political parties in this campaign, but that does not change the sense that if the national public broadcaster does not air programs in the national public interest, it calls into question the very need for a public broadcaster.  Indeed, the CBC seems to have cut off its nose to spite its face by doing its best to prove its critics right.

The CBC’s odd coverage choices are not limited to the missing debates. Its use of video clips from the debates has also been unnecessarily restrictive. For example, before analyzing the recent Munk debates on the “At Issue” panel, host Peter Mansbridge warned viewers that “we are limited with the excerpts with the amount we are allowed to show.” A similar warning preceded the discussion at other debates.

Yet the reality is that there was no need to be restrictive in the use of video clips. Canadian copyright law permits the use of copyrighted works without permission as part of the fair dealing clause. News reporting is one of the enumerated purposes and even expanded clips would easily qualify under a fair dealing analysis. All news organizations are free to use as much of the video from debates as necessary to highlight key moments and positions of each leader. To suggest that the law creates significant limits on the ability to show debate clips is inaccurate.

In fact, the CBC’s misreading of the law is not limited to the use of clips within its news broadcasts. Just prior to the election call, it asked YouTube and Facebook to remove a Conservative campaign advertisement that used clips from a CBC interview with Liberal leader Justin Trudeau. To support its takedown claim, the CBC argued that “no one – no individual candidate or political party, and no government, corporation or NGO – may re-use our creative and copyrighted property without our permission. This includes our brands, our talent and our content.”

That too is wrong. The law features important limitations on the rights of all copyright holders and all media organizations regularly rely on them in their reporting. The limits of copyright extend to campaign commercials and there is little that the CBC (or anyone else) can do about it.

With its rejection of the national debates, its limited use of debate clips, and its attempts to limit re-use of its broadcast content, Canada’s national public broadcaster has marginalized itself during the election campaign at the very time that it could be demonstrating its relevance to the national political coverage.

The post CBC Shoots Itself in the Foot With Election Debate Coverage appeared first on Michael Geist.

Michael Geist: CBC Shoots Itself in the Foot With Election Debate Coverage

Appeared in the Toronto Star on October 5, 2015 as CBC Shoots Itself in the Foot With Election Coverage

Hubert Lacroix, the president of the CBC, recently placed the future of the Canada’s national public broadcaster on the electoral map with comments aimed sparking a renewed debate on future funding models. Lacroix disputed claims that low ratings are to blame for the CBC’s financial struggles, instead pointing to the need to consider alternative fee schemes, including new levies on Internet providers or supplementary charges on television purchases.

While disagreement over CBC funding is as old as the broadcaster itself, the more uncomfortable discussion for the CBC is its coverage of the current election campaign -
particularly its approach to national debates and political party advertising – which raises troubling questions about its relevance in the current media environment.

Most would agree that the CBC features an excellent group of reporters and boasts insightful analysts for its panel discussions. However, rather than working to make itself an invaluable resource for the election, the CBC has been unnecessarily restrictive in its broadcasting choices and in the use of its content.

The most puzzling decision has been its refusal to broadcast debates hosted by other organizations. The CBC may be disappointed with the debate approach adopted by the political parties in this campaign, but that does not change the sense that if the national public broadcaster does not air programs in the national public interest, it calls into question the very need for a public broadcaster.  Indeed, the CBC seems to have cut off its nose to spite its face by doing its best to prove its critics right.

The CBC’s odd coverage choices are not limited to the missing debates. Its use of video clips from the debates has also been unnecessarily restrictive. For example, before analyzing the recent Munk debates on the “At Issue” panel, host Peter Mansbridge warned viewers that “we are limited with the excerpts with the amount we are allowed to show.” A similar warning preceded the discussion at other debates.

Yet the reality is that there was no need to be restrictive in the use of video clips. Canadian copyright law permits the use of copyrighted works without permission as part of the fair dealing clause. News reporting is one of the enumerated purposes and even expanded clips would easily qualify under a fair dealing analysis. All news organizations are free to use as much of the video from debates as necessary to highlight key moments and positions of each leader. To suggest that the law creates significant limits on the ability to show debate clips is inaccurate.

In fact, the CBC’s misreading of the law is not limited to the use of clips within its news broadcasts. Just prior to the election call, it asked YouTube and Facebook to remove a Conservative campaign advertisement that used clips from a CBC interview with Liberal leader Justin Trudeau. To support its takedown claim, the CBC argued that “no one – no individual candidate or political party, and no government, corporation or NGO – may re-use our creative and copyrighted property without our permission. This includes our brands, our talent and our content.”

That too is wrong. The law features important limitations on the rights of all copyright holders and all media organizations regularly rely on them in their reporting. The limits of copyright extend to campaign commercials and there is little that the CBC (or anyone else) can do about it.

With its rejection of the national debates, its limited use of debate clips, and its attempts to limit re-use of its broadcast content, Canada’s national public broadcaster has marginalized itself during the election campaign at the very time that it could be demonstrating its relevance to the national political coverage.

Michael Geist holds the Canada Research Chair in Internet and E-commerce Law at the University of Ottawa, Faculty of Law. He can be reached at or online at

The post CBC Shoots Itself in the Foot With Election Debate Coverage appeared first on Michael Geist. / 2015-10-10T12:14:11